LExifMM*  _ (12Շi$-'-'Adobe Photoshop 22.5 (Windows)2021:09:08 09:18:340231 _ rz(HH Adobe_CMAdobed            r" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?7='곱?q-xڜYck$.luX<$1 c> MqhlW\GbZg)HouH{Vޣ/d=eLk=Ĺ? F1%rCDuv~G?it1~V:[؟]Rܹ|-=#~G##':y8.VNvKgO Y [T(lnDpdׄpKV.R32bF],:&k6QI>[5p]F%^г}W;3p!ojA쾨c2ms{1p>3gW^{"@xْl?B}'}RQy?;>v_\@g;fKi^sݻի'YcU#OV倈f~[4JQ{Oi]ִ|Nt&.&r&Xl-۫Kw֢2 -$M^I%)$IJI$Sᄈ5՛ZXK'|W.]A?Kُlf;e1\C#Ԣw2ZbzcTI8[?Usr :+.ANcFݯ_lV[+`%?5m.n9wa>C["[3j里xV뼽_2 zƭntqݏ\w5WIJI$RI$I%)$IJI$RI$DI%)T=9Z k?kξ*z+wڱk@ϫc55ۿ7)כk0u"j\zvdMQCkeG[)ou˄&^_<ݔKgmE`F;G͏s#v_k/qwe>^"U~݌(='s7U?\?ۤcWs-i6~s}ߘr +pmnq}pET`2ީnHun2~~/z6__U$9M3k~f -<ȄNoOq]Ry@]nUo"$I)DI%)q_]rv &솗׻k!S]T1Iگ9WcƇYm41Ukd{7fznb{g5>qrճnŶOZ7Gݷ~{,&,_qwNX~rϣ93hK &>KSubz ËvtKSldJl^{2̠ݎ[vv[75kуr)UsYSH:IƮ̌z6Xi5|:zcu<MM^FsCو \9:'LHŶڭuN$TY􆿥"zm-/#:^G1V=g9̱ߐoxѮV -Va3 7%ߗ``eC%4@F, &')dxO_ݯs(]fUD]Y?+wN;& :zn9$[ ƽeVhstX"}ńCc>tӬ9RE;cq%՛+#V8,e ?4}=֬뺮YɶCXֹmۯ*jecxkƾlrpÎBďز|3DJ62 OZlj<91?礼tw\D-;HR0􌀹`ڽI6}mm^co{ݸ[C]v/Fe:$vYP?Jc'u_VE,kCxs\ v-W͐`$LgDI%4Qot/#˷3"̛_k#S֮WO)>]N>΍6z3fYlƘ`&BV86"ک_dONuYzjeQhi>]?Е1vEݧۖ?.ُ7cu84 ݑN[ dŭszuٖ;j_J=+=oc[;v9teNeÖSc6 0]f%. om`sʬuYeJuk[^?Oo9#`]9T]svZX^fk!l E'췧Ih1Z98kx<5Fnvq cqѕ ް_Ds6:MOvKX쾥{x-'f{ZOj.*@4c8b`G.NӠضͺ|.+ 48~ǍɁ?ggٓ>x'maq\b=hAOjkGI~{I8?g5a}6d<= @.,#jTwl(>=MKqv/i9vݳEX|FqoZ^e+/kq3kj'[Y-]]ϡ$-TϭofgwҰs՜Z#Gld*p}ك[IYq7|}R[F/?Ud)L>_eg*@.Gor#:T#f\)T/V}oSx~j~uq}r&H^Tzôm?3~^6[sb 0+PrN8PyV?L:Sh'Nn%Jj_Ѻ}z?N=kau#i}>VH~.ܪlsGV( tk!NoќGh,J9w,gb.G_ܙ;|wscC^NqK%aԭ2?+TŌ TN<;N:Xo7x` sL?IR=/I-ɺM6/mN$,_OPB*-1MV;_l{[נQηl{v!u{DclAD$ꔗ$ꔗ$ꔗ$ꔗ$ꔗ$ꔗ$$ꤗʩ$ꔗ$6Photoshop 3.08BIMZ%G8BIM%}Ǿ pvN8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXTBrother MFC-9330CDWprintProofSetupObjcInstellen proef proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM 8BIM Z8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM@@8BIM8BIMi _cat_blanc2019-2020_foto-17 _ nullboundsObjcRct1Top longLeftlongBtomlong Rghtlong _slicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlong Rghtlong _urlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM r Adobe_CMAdobed            r" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?7='곱?q-xڜYck$.luX<$1 c> MqhlW\GbZg)HouH{Vޣ/d=eLk=Ĺ? F1%rCDuv~G?it1~V:[؟]Rܹ|-=#~G##':y8.VNvKgO Y [T(lnDpdׄpKV.R32bF],:&k6QI>[5p]F%^г}W;3p!ojA쾨c2ms{1p>3gW^{"@xْl?B}'}RQy?;>v_\@g;fKi^sݻի'YcU#OV倈f~[4JQ{Oi]ִ|Nt&.&r&Xl-۫Kw֢2 -$M^I%)$IJI$Sᄈ5՛ZXK'|W.]A?Kُlf;e1\C#Ԣw2ZbzcTI8[?Usr :+.ANcFݯ_lV[+`%?5m.n9wa>C["[3j里xV뼽_2 zƭntqݏ\w5WIJI$RI$I%)$IJI$RI$DI%)T=9Z k?kξ*z+wڱk@ϫc55ۿ7)כk0u"j\zvdMQCkeG[)ou˄&^_<ݔKgmE`F;G͏s#v_k/qwe>^"U~݌(='s7U?\?ۤcWs-i6~s}ߘr +pmnq}pET`2ީnHun2~~/z6__U$9M3k~f -<ȄNoOq]Ry@]nUo"$I)DI%)q_]rv &솗׻k!S]T1Iگ9WcƇYm41Ukd{7fznb{g5>qrճnŶOZ7Gݷ~{,&,_qwNX~rϣ93hK &>KSubz ËvtKSldJl^{2̠ݎ[vv[75kуr)UsYSH:IƮ̌z6Xi5|:zcu<MM^FsCو \9:'LHŶڭuN$TY􆿥"zm-/#:^G1V=g9̱ߐoxѮV -Va3 7%ߗ``eC%4@F, &')dxO_ݯs(]fUD]Y?+wN;& :zn9$[ ƽeVhstX"}ńCc>tӬ9RE;cq%՛+#V8,e ?4}=֬뺮YɶCXֹmۯ*jecxkƾlrpÎBďز|3DJ62 OZlj<91?礼tw\D-;HR0􌀹`ڽI6}mm^co{ݸ[C]v/Fe:$vYP?Jc'u_VE,kCxs\ v-W͐`$LgDI%4Qot/#˷3"̛_k#S֮WO)>]N>΍6z3fYlƘ`&BV86"ک_dONuYzjeQhi>]?Е1vEݧۖ?.ُ7cu84 ݑN[ dŭszuٖ;j_J=+=oc[;v9teNeÖSc6 0]f%. om`sʬuYeJuk[^?Oo9#`]9T]svZX^fk!l E'췧Ih1Z98kx<5Fnvq cqѕ ް_Ds6:MOvKX쾥{x-'f{ZOj.*@4c8b`G.NӠضͺ|.+ 48~ǍɁ?ggٓ>x'maq\b=hAOjkGI~{I8?g5a}6d<= @.,#jTwl(>=MKqv/i9vݳEX|FqoZ^e+/kq3kj'[Y-]]ϡ$-TϭofgwҰs՜Z#Gld*p}ك[IYq7|}R[F/?Ud)L>_eg*@.Gor#:T#f\)T/V}oSx~j~uq}r&H^Tzôm?3~^6[sb 0+PrN8PyV?L:Sh'Nn%Jj_Ѻ}z?N=kau#i}>VH~.ܪlsGV( tk!NoќGh,J9w,gb.G_ܙ;|wscC^NqK%aԭ2?+TŌ TN<;N:Xo7x` sL?IR=/I-ɺM6/mN$,_OPB*-1MV;_l{[נQηl{v!u{DclAD$ꔗ$ꔗ$ꔗ$ꔗ$ꔗ$ꔗ$$ꤗʩ$ꔗ$8BIM!WAdobe PhotoshopAdobe Photoshop 20218BIMhttp://ns.adobe.com/xap/1.0/ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$HIJI$OwUĩJKI$k<^AW8O%RI%C]>JI$T dI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$w$$H@E< $I*ewP4vVҔJI$ebyU^$JI$RI$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I"nxonI )I$p{g:TAhѠQ.۠.I&:jR<{!yXe䒊-I&NvۇQ!ctjI$*?܎ $J7R->D-2*/onRA I$dI%I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$tIJI$ԗ;s Cc{~'O%%)$JO u3 ]mnAIm$V=pxSm'kRU$WTlg#dվFhRI$8I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$i-0NlxI#iNHwO`Me$I2I$$I$I)I$@µUªC7I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$pH&I%)$R/s*)$I$I$$I$I)I$JukG9 ?I1N7'Ir$iZrρKNI$I$BI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$Gs~2Ix?*ऒI.[tq%ZHcPTI!I-RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$Ee?AkGuz@RI$HI$SöYN.PIaY:I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I'(RPI$5l'S}I93L"I%*~*Jm>>MY$$I$I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I`%cz~" ZI2fa?BI).I&Q{?#t )I$&S$+I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$31Z%RI%6hʺKCEl?Cth*^)$LRL$Qo~MjPkah091ʊhY-ԒI$I"$I$I)I$I$JRI$I$I$I$$I$PI$PS> )I$d> I(/M%)$QIKw^RI%7xJRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$=XZ$%%)$@I]?rI*I$$#_gTI*)+bħ~%%p$JJwt)$$JKDbS/S%p$K9%Z|ޛ%p$Y-~OW RI$Z?f}$K9%Z|ޗi?zJRI$Zf}$K=%Z|ޗ٪RW I%5^o$JKC~)}%p$Y-N1¤If* ჆I\*I$sks%Xf!Z @Q.(&I%RLSSҗ1))I$I"$$IP;ʈZTIJI$jKL[hQ=?Q¤Ig$5^Mj?¤IPI_5^Ky+I$J_J*I$߱R3B(ITIW+B_ewV!(I4I*ewK+$ I$>|B_g>!XITIV1Oo4xJU$Hf7 BJIOaQ(ITI x?ٙQa:JI)}h$ I$~(`숒JI3ZƉҔJI$')%)$I !%)$O0Xr}-$)$PY--%hIGo^|%)$Q/QV$IzmKc|ZԔI>ЛjoX$$JP%X%IJ<%X%IJ<%Y7I$y% ^J$JpK IVIO:kÒ#)$Uma솭xUTIi I$$I!I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I%>I$I$$I$I)I$I$JRI$I$I$Ho )I$N+Xy)9ҘI&ԧ条;X >IYXǴPRLL%2He&i}ȢI6#%^.j$]$GЁKիܒI$<կܛկܒI$(UZxJ]$RI$ Bj\I$_IVIY%[կIz)%ZI%gOU}j$RI$h%W播I$Z*< ^< J$J։HU}fxZmI$!-TR~QjI$-T~vx%ZI%osR$*~|ޤ2~jI$ KU?_?<ޒI$&a{{7}*ԒI+A1pU{;og`cmI$!(j%@播I$<9(r旪|RU$F%AOXRI$. orHY⒔I)|T- 9J%0;RRI%E,;O!E]ʫ{wG*+H$I$I!I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$H' h $)$O\$t$?W)$RQ$jI$}z}I*ԒI+>|¬J$Jǭ®J$H z $I$?|B^U$G%+@I%ZI$[LmRIVI>)bJ$HM44U$SJPI$RIVIY?QBI%ZI%3dM-I$}-2I)I$}-2I)I$}-2I)I$}-2I)I$}-2I)I$}-2I)I$}4IJI$IJI$I$RI$I$IMtVd*m;H>]p$QyVPQRI$I$I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$֗0{?lqw:- {$$H$|VF7F;pI I$RN$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$c =T֋ִyEI$uZR\QqPYWP-'ꄢ}wK ɒ:I$HRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$MŇݫPIJI$dBr?%qI$n,Bh I%I%I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$%yT鏊*I$M쥍]}NSuPGI'e&NRI$XI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$lԃ֟g-VDEI$PQ2 $줒IWI$XI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$Vk-F|Qk>У=ۼRRI$$ZG% RI%>QH$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$_I%>I$I$$I$I)I$I$JRI$I$I$ Ӎz I)Gy5Vη(߫EIRXII$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$b,cQ\6Y:d邭 J_oJ;)$UI$V$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$D鏊Va⭔B$Hu>rxҳvR`2I tI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$LOe![ 4IJI$ )1 >Im35IK%I%.I$HeʹRI1 r028|D(;IKt$Ҳ0?f~"> )HOȮ\>jFĒ!TIYoOy)F&$ & Ԥf̨ +2"v)WqkLr{$HY}u>*J, v!FH"[ *6$ zTZow6͠9'\;!+ i! ~> ٦O$?adza 2`tJIB .-Bgd0k3> -%~Zlx&,VIANfjU6@ \`B`<(6WodrI;)$BI$XI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I(IJI2I$PI2IEf=-q:fQ%; .iKpURZ yFoլ ̡;[1tw%7'UU2z>ѹqrYIJOtI+ (]~_s$fM%l?$?] \_DTt[v<*!v=׏R@HaeRBDr@/r=_ L/Y ՜cO.(Gܹܓ$w_O$GwGdpY-,DiQc۠#r⮒iIPIh7^`4Cm .iqÒ .de$HWI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$I$$I$I)I$I$JRI$I$I$R͏UI I$vBd.RI$d7mjOCB<S؍F&* I2u-AK >=I$IiqɈAoܲx)$Yi-_28 }$'pIe$+8)bOg)$YIB3y;b#D RI$Z—Zy$}}’I%l}H .oIGI,J%3 #RI,%vI$K%%f0IrpIe`&9I_rpIeYĮ,⤒Ie#$}'I%p0G&3I*I+)}$}/e$JJĤ줒IR^ |ӜvLI$zuq@p75Id|褒IVIH"R]$I֞Oupw1Tí<5'ںL]nq`u# U%-V_P,kA&NEUE%ǂ"]^Z1M r?Nj`=Ƒ" Yl;?54ÌG3s9C20}Hl~X?1ywvk-zV3>Z v<z==Zt?r6'px%UQ'۪jnu` ^O`"#b66qd'~vhDZKlqV}6>v!_0?AsZ`_Puv?}Z`" vZLw?ֱtG7NX; *aMcSAO \{ NTNb a@D.}W*$i?tCD9tAkx'ziŮ;~\ET{ݵXh,. vߥ^De69qXTt q- "U6"=W,lM$A|KV&TY֜ͭs,; %T Xm?jC+sß~sG>OEؖ{le3z&7=m1H'88H{\ETSLg- ͸:u^cd[֏]e-ȏ6ZSasy?j/?'_Eoh#VA[$BKY?.?;:lpxo3 _ }HwniLgq }=?U>1H>] )gw{Ous#wZVTgS^3Tz-Etި649Ēud-]?MňkCd8&=#͒֩pa/a;?K%tstܛ Yn}Ybpl3V%vS@54W E!eұ;c|E^4֣ouzp>چEnsgnJVJi9v~Y=Ú ]UqK\灠{_Eҫ"E^ggst>B[/oLY!qDEn+,|I$py7O%jfp{ؑ 1ַ@OvڪmhkXI!Ia-ڤX׷{|Rqmn*la$h!Uk}&=i?<{qdKi5.5hum2/x#$'QX`[]i!G pn\<&#uqĎ=v%jg]V-i{ hp=AUiՏYh;?D ť5;GA}qusAh3hecs7ObI-2 n*gZ)ZӀƉ}ii;NoThkC-i\lgk]bǯԱ;. a.fyI25l/-FݻOʈi#W; KdF`8;[SՔ=@im&Z=F@D{%ۃ5-oK;0~VȰlqi'y?Jʼ4c$O'5,qyǪ-}ms+@Fe޵mȗwAyh]!W`!.xPKXu!EM w͡ҟ좂/-גN a6$pmAD̰57Fi^3{Z$m˚)2ʉ*#B}! )5lTCݬv ;s)1;U:v6lz45?f#dl$5*#(?uZ/ %6soHfq˺T0$ Kdj6m=oMssj>cVy_FgdvKמ #Ր@Gh6]ԀИP=@rb'huK]K6#DAG% gs}+蝰WjS0?@x!EBH!.y_K@i=3p)-Oc]0ė|?R// i>ؒzwG33fi2ZO~ɉ@<UhA#di2:܇CJLݳ)T{{L9 \YԷQ[i$~LV - kw4 _gO!Q5=퇹gx4Z,ys'q%Le]nƵjv䴍i w9 #psmiQ)/.! `Ӓq)XJENZF{h<7eF{x(Lza-ON5?LL)./h g @yOw~g8 {-2c*lFjyO2cqZby^FS:vyi>C>*ӚDAxmlRoP)ÉtI$I$$I$I)I$I$JRI$I$I$ôʊI)I$vVZ[$$H՘*@ O?"t pu>*I$ę%F;H.$lL!$vERI$4 tS vU)$C#XA#AMILv¤I@>I]S5 $ҒI$³ h^-&I$˧)ʞ{&#:KxiI$іTӰ$WE$I LD3'{MDI*I$6rg2)!-;"I%# RE)$KӐDMHBФI$dR5 ':$E$J-ri)ve6%I'8OtI5jI$H^@nu$xD{RI$|xHS-雬$I%x&9Mt:*O$pt 'I$2L4lǚIRI$FAߊ!j}FH I$n tZOI%ptIGfyE-IO (I$@i-RI$8D$J$|򛺜AL$$H{$G`a9:Ꝡ I#*I$M>#D9' RI$y 5kC.C *L%'m@ԟrre$@TIE*2J}FTZTI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$Iլwn|?=TRkH#BHI1KE/0GCWi"Pق?%tgһ0F2k7x\k^ډ/eHй TƺO}BqI$yPSk[XthI~= \k 54F>i=AFA- ƭs o)XIt2PHnDI= $&?k8pֳَha V]o;{ ;q '4"͎xI;m,,h Z4.KB yo‘ >I+qA$s\w )_Eg[.tl!݃p1p:89;ÃKQ `,ݿإS0Z9D~\Y)7qtG4}&p ^]lv6_{mE697m%=?m-c O&?;zkƳk@zcw54#%%qnsZ'ԟt>V$>{1 ӏ.q- s7?ޣMl!$>V>tXH$?r5 34KFA;zJefORi!ޛ>K'O:64>?>mxaady'1q/ x v--bkw$%&0N6]6':]-'T[Y :>ֶtkϭG"@c,-d}-=mPX,c;}q!kXK}؜G V{cd}(?ZSKdɤ--ͭpp;M3iu՗b>nֻ+Lp>` {emIo?F}nS y3*&X fݣsky)!(/DOqwѭV l#e5 ;ˬ/qegqgZ籮V#?έ 6? 5}2G"z{\c^lkƒoSe684#{ƳI -py?ѿ/6pdmk4fUm'ݲ@iy:}%H0ƝRG1 k$gVx"4S DaviKln8v5;}oN!ZRvXS÷Íg~"ָ&# }D8Rn>g]c_UT48k-IKϩi&%CR9t@g4fw7:nٖ˿M]]k&h l>`lhpF?L84G?'y0X\[[2 RJfXOFWBK2$5dG%DHm2_TT﩮l@䪙.{KkCFSQcck@3I5H<$e5*I1{7z^_P'h7&#]elݩh`OSQC,q/몀~\?C L@Nk^ IH-m.2בh ,OS}^k*{u!uV42@hvk?Jk,/gscF5k搈lt$E?7N?Jm} WϽ_As@}c{\\GogOESa Ɛz/kn\ݖؓ}͟M֙ 8Bԏ1߸= GcIL gG))V+Ch-Vhhv=F8j/ƴ>'p܁n,h#G}M3 D}?u\ 105N8,.k HcJeK,kh6Zgއ̶ZPǐC@s#E3^E Hʜݲ#t/&*kl@ ϬZU7;S^o7 .:DK4Eg8oC} 2TmH彣 f{l C'WkQ |Q +* Kw:534['SGRZ,w Dh 8Ϳ 'c},Me9cu~F^67pgHPAyOXah;o6V ÁҰýO)sN[YvUFkw;DH;s-c~p.6Kla;DjU֠@l\(I‡יi^JrZe>lkvrHMu@W:y CeM!c ~+D yP^~v1Iv409ﱌ{{8RHESS[uk[ _Dq9 mvXMe6iG1[grTmU tn"q'?COv{]ϴ4(9sݦF뽍 wԶk7:~?؁׎f46w?DeIuup:LWiA;m!nM;$'w@4cqm{@&ݎAT+.i/'3' 66p? #ll˚@?ʬ{)k9pѦ],}vlZXc>{_^֝_+{q|TDckяD~?+b^352LOI$tI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$ygӛ' y6*cx /K˛E1{|UԞ+s^%Sz.<| yxԏ]ߺlxGzg6A`{q {=Ip~%??51dƧO ce; /eLp8SoʤOt?Ιw'4IPt'A3?M ƽdy Q=JeF}I!ǏbbG[Ɍ̏D~E&:JZa4280^g @'J 8gs6g)4vR^|S7>#óRqˏQ$8| mħ vAJ/N`R@{3yqПԛz {<Ԉ??r~q4SiCA~t ͷ$Y}&'Gv]@Glj8Oq`> &gqFvH$~@a9(31 h? n4ϊ4ԔD%JNH~hR x.%ÆH׻`xńyN:xR5z^GR`GRi!?9"$|G8=ǷJHlp}#IIcLQ `t"O@ҘdHgoi1"C@P6h6GyHP@A2|k'RxKq1%Z] pICeլ 4}/o^lJa# NO8Y߿Jg '"Oz'ACMNwFLF .:cͺ8N'LI"¤I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$ $JRI$U{ijtXxkyJ!mԻ)$Fxh.ӍhtI?9$PAIm;Br6%JI$vq|TZ@ =vfSmt|MI$˶~iXIéRqi@$kU$IoIR >\y(`jNU$ICH<&h$)J1MtRiNR<)պvKu{$$J%(dV[ĎnsuI"I%㪓k`T`iI䖆 ~IJLKl6gRtRab'3Q-@%'JII$[5tDKi-3@ ;v85@~tM4D{n-@ahZ8RP>a?O޷"32}MW׏t5]eìq!S% [m$❬B6s=<$O]NZ@%j X8Io] ?sDC xs-y " _7_ޘk:O;ʎ]t1 ))\,kNCZe f+kpcݭqoQQv49:964DG<vm9GGSݬq'O=P ~wQMĺ HSվ]e& 7)1m0&~s_cX?ͷ;Mmn> kk\b|j%!A2c[OoꠂZ8 N%6ḬgV#7~r]Q e΀>?؁Kq`5/v] VeE3~0~w~gIOt2oqpvꨳial0D=Ma{}E$1EakAo.ze[I.KE4%;YǬNO5{;kK\Kk%"L>#,$>vkIIXڃw3.͏Pyu~0X;&35ۙ1XvV(zc?'~ DΟIZ iH=;Zwi1%'=ϧuچQ7X-j ms_hpdnw7k7m~g}N˵kIΉpIO^6""!(O<@~J=&w;7S{w9=Hq$slmUXT==K^X!--a/kۦ(TCKf 9*aҷyIIxuocmw M^٫fNٟ.Mt1ֹZIO^id q=n:뱭S<Ԏ6K>͏{F{{bR{>Ѡ` <i @?͠S{,v>?joˈ2MM?ٷqIIkop=C`4M{NtԸ=JZYqx؅hfayp7k=ŮOA<9l}/n ''7i#zLl2ѮW ͗:m$ϣRpap_~t`c0AcFYY$zi$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I'RRI2> sA;wo[u`NC4xqDbh#Ylpf Qzee{ q$GF_vZ525?LQ?m!:rןlh *n;-tOl]v$Ĉ#Tga?.Q`'M{ :k Ʋ^NӠqP.kPwt.F זl[Yp!3!ꥷ}mZ>b*O&~Pk piOx*Ь. :ÆyqiyBK"DsBsMu--oh۵c@ mii>?VrMnoUX%;Y?L&ոL'mDO#"lu OMZ -k ݴ89.c^is%;}k6zuc9}M(d8K\_omfQV,Κ N x3 &Jt)6mk8q?H95mC)vZ_A>?E{?ѱ̏QS\Zߡglbzy}BE}'Vw6oc%{ihĢ- 1nLZ-|Ѵq}eZkl{mwV= jϭ۶.{qPe]g{n s) ߲f>k1ַg}Y \Z]|7FbyIk;]D찗'=Y?GaĺжeW{wH; xzfh,s[^ ZJ5q[=M_S TX{]gY8#6Xc\[3͍{ڭ~aj!oW ^.έ?h"C]鬒 s$GG?KO*{"]qRg濨Vla'pOw~ǵUKڠ׸ [?ՙtPKkd?PUasw{\x(Б:U[iZ [nZG.Ϡz3ӛksOBwf\t4{Y>K s^ktU^FR=fyOHXֺwis`iu2Aq$č(9X^;RMe]ks\t 1?^eVa{q~?H2lhhn?voE}LɢXamLځ`1L!ZijգC[^ k\h ېYnnᱻ=gVhq65@v8Ckk{dߦ|Mke׿wl* 潤{?<61H ikG6hշe;s^vi(me o"AR{C,Op=?]}[e>}y]85d泖 fcgCDD,~;g[qkv⦡\ʚdI$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$%?LNA${| Zo|D;? #I$@:`vIk"5G H@L$J w:&?y@S "DI'{yHGҐOQ3DOGJI${"45JA$=IIAI$+wHA2kAJ]$ԃA$TvN'NL@2'TI! ?*>4Q"(8.AAħI&1̩6ͭ:!m䒜m))$Jû@xI5kH n|UjL^qD" @kD`x$]$:?&g?%&Rk( 1)$Im29ۤya$):dC@=hR{v4r$Gv'I6h& h-1<Ca$RILp9OΉH4 $BI$]4Hqࣻu*{K%$dάn T q"q.AwDH!t'QMyI<"g!w4TI(tk'ny8p뮉*I$p!#Np$|L肔I'/QC۪q*I$Mt'#Gq&O'U>Aq;&AЁ$ILVuxRG)7a:,y<~A$ Y:I,1Ƽzl΁e I$dI&I$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$F[FAoq]^ G?5ku޵ꖍwIqLhb?]%2Xxdvor,抲 ^@Cseu6{O%d9w4TG>= my.tn9F\񥁠AnͿbk75A'v8ƤXM-pKq( {G?"v87P8} 7x}_UAQT=Yq@hIJZlv?Ef; UGWkZp[ȇrߦ`7xsl95 qh.w>";) ʧ]?~ʲrk\#ݹM5 \ F!=m'6g?DwJ7ȩ \ 緒l2ؙ$xƖpgMz[HߴN# S#>3!GjU66I>>?Z9 G#it$I48N׎}w%ٸ[6F;~ G; 5][-qpIwbMskkYZL{)87}& b.c?H~GH\ fBnH4)nH-'I)q[H}͟M=Aخ]KOX{@^@f=,Cެll<9-ԴI:m0g`ƼՂ $|tQku3䒔m!xpTBv;׶sdg{{jCLm׭u~?]Ln<v3r ?3H㒒2:ڋw7ggV`,7646?Gr6 y{$7UVjkݐusO|#scnOfs2OGb});$#' Ŭ:5c~LƩHv?! o+;Q~;aaf=Yȵؤ!xh #R-G|uR4d0`ֱ{̀+QWE.fQmK\$n]]o vj?DIh?.ɨWeN|J M]}AI v>5Mh7D|}Jbk/'_ߣg!,vn=sv'`8tOѯw;Qȩ?Oiq|C%_~Z)% v[\ZZ873dR]lr1KMch;clur`'#eiIh,>A P}rh);q="0̂|Ĕxc&4b%Widrʬu0`~@ ]etPmdk fvq~soI++{$푨=%1<5AݟJ˅A1!,);!Th\g7إFMT sNbgnH8;nLm ~*ov;5%.ֹ vγ'Cjum\bvt5owM>v0ѯ_Oq;LK`~zM -;(:אؑC=%,L-hf~&[e e`4_ m'!0x._"7ua N?D#Q`Nen$ou`1{Ԕaq|k~ߤLeP h1=(uf@Ớo *ek]n~=R2׈ -:ims'FGoH hw(uh5%0 )~clfk_oK!94jWbL8=?GkF.3 }k>鵲1dnKq'7G=0>vX >*, cYHkh~U:0Z|{CnlO?)tI4x0u;Uc ?L kF5S=ZgDv.nGZ--sɗ; Bi66#I=}4ͯcek3ަ7Z xlo4h<ʚ$nQT>'ô ),qf7k(s̟gJD6> ?cأI-3588} ī{blw4Z䈄捡C?2ᵒ ]A da;1|v߽+`;1o5\x:bvZYv7! ?a;kkKA Ђٍ$023 ">3]aK7gE\4}/WT<;g?h uvOos;1dsIgMGR!H1?9A }I*"N*ZO76I!nlw?@̰^S@{wr0X\D9nڱinwi0T]gݠ:A3B@WmЀLH~6ciF?F[h-/sH;OsYI8ƽۻvw?Ldi↑?&6G%6keuPW$Ii}!)o%ٖy"?T,is]n&cmeomf#\]5u5H$ .KKcH)[-ג6AI}~k2 Wݵݺ~5h#PI$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$IL$&NzoLHsN6idwf:<z=N{QRQX'&T%gz#0\?Z9V, 2sj[\ UM{L$''vesM~8<5g{kK.}>ƆݬlOG$Ɔ7mݐ֍cDƮX2AOqZKw3lQYE8XH"=O4?jźDr=”d?Rm|t&=R@{s7?1.t5%' U qi/pGk+?gJ6{}Kh7$5e'>,ZwHwb4!u5] p $ k&]h?`#W56A,{?Dd4:S>惸aoUﺧ5cbN~rc[ZN8U}e4R_" RAV0}INϱ 6ُcX p-c_Imw6O&36Fr o[>ɍ4 j^>5 %i!KKI\IT&n5ֽqs~8  T -%?[Mvxeo 94XsC` s1=E4nyhkA:u`VK~* p{e̞ڤ\}V]Fk' kFhh6ƏsB括8exa JE\ZH=w%A$ԋK'qhy {>:I'\ F5rOJױA;_2o1A32HX}$}1~=F+yA=_,>׋Mka'3g`#be&{ZG^RG AsuٵI7}?Dͱ>a d[V}FRk["bZѽze`8Gos=& ܣ4kc i rFom:sis_g]=V-L⽯%5qCx ߤ5]^(&c@p~g];0,~ww`XѴ7R`{UΞ~' ԔCV ]~e~gSkkl@5}8F}?oN ;} I7T{ĸCd5vˆPk~v=~z[nǼ}]rhq88ǷOslwŢ|8I\ UX^+, ct]oO5W"NA2 L!I4qIiݡe\i,&Hݸ~ZjuMyǰ+3=v4>} eH/5O LPwZ'?EA^d5QX0d9yx0$~xmcZmgIVqZ*o^J}>1UV.̀akH?16Ss CԮ`spmI Dݶt Z!9q:7In8:dC1E{29:Qmy`3߻W]c,&àv*-5hn==h1dn&F]ݴm AKmqX@ ݹ!$wicc_CL3kF{ ‘_g;~z?WZ&%cѶ}fֱ]WD6:~ߙSZ-[8?sB0I{mJ'&ZX@:cJ7kO,ѓۆ"ms7zhM4d浌L]ln:%1?饓^57_Okۻ󎿚7ފm~UˬS[5to}S=/?Ē4jk}LfVױ^-2p09оK2jv`#7k_1\̶L.D kDLP铧0?MO(8?se< t.K)pOM&]"m =UT1,fր5?֩PUuL`yo=Cs\Aƚ\9O:*Jtsˋ,z i 'LI"¤I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$ߡdx#t)l~SIޞI%7N' jm.x&p45)$&uG`ĨD L1%QUI%-F#^8$Y&6ÌRICn NH٠ВJ$GfMdoA+&uKǹʓ[E ZAp$OpHc`̙ׄͶ=ų&uR]lkl% KI$&lq|k}MILԦkLRo@'"$K*恡$I ;mP .Li }*;kAVa Ic(iKx@<<ˑRJ{(L4wtj $Lʙd3#w-%Rt(vѦ~ !vu$QYS^KC#WLDKv8{):L6wk&h$I$)w (i:]^8F!3l,v5?83.:jJp!I$)$6 J_2Gl$IoIJH'L|9-_=T=@ OB^upl)%A$(6dgO|55:L/pN-[җL%8nǀ dpkbDN5TTI5IűN>.:iH6{;(WCF;A;&urdj IJ)4O?4^腏'H7c1߹zH+%.J;fOvn"N A'vߧDx%jN\mGS5Ӊ(I ǗfKbf K5` [&]tyl} #vƱ'i>mlơs.G w;iv!FRx=6%2 V@mEE#Ue|@-:%@ {$=q FQa;RoP hďY0<9H`!38AL;Z0{M˫omߺHoG48Vam}F58{k'>Oe _%}kx$p|Yf <RRָcAh􆱛^!g?}ԱT> ?jF604 bw ;{x khgC9A;lvǏ$zvnH:Oaҵsv[KUnm[G"v`6#vݞҨ;S@uLkh;^n9cc& BKYay`t[v@kvmqipk?iδw)-y`;GP?Q_cɐu|#EL N-68w#p;18@v>螫n9E-nׂ!Ax;ڐ&s'$,1t yQAlIIie_/m0$c] 5I*!{[s69J#~xpx~H"[SݏxmڰE$҃0p.1Ƀ]זT[KZDi?RH`{)%] f'W}:'"wIsSc2aWh?t\kI-w=Ye\xIc?OkZGmv%"\gI-D'9ux4V!Fǖc/c8?ᶻ/v11= Dh;%nqs[31'as[OQ`|X3)1ķ 5R4 4xI)I~@}TI,tmӻsvckG-+YS-6N qof(;9.#ok4V5v=nkd&Ȯpca8nmL?KJk6 6oKañZZ9mm*U~6's\ϥ^~t ٗzlR.! '0c~_Fy7 lrA ?S `c,kNys͟^ CǶjKFq`''_[.59JHekiND$$ML"Dκkzq?ĔTX@L^~wϥ'W?"آc = +5HoWz~".l`~?XIKAp'EĀY%7]ͱf洰kZFc5 6$'a*ϩ<ý2Ƙ%#v!! \v {o/RLa݁#}LHs?Zdsow뮿IJk}[?;c*){}ޛs^,:$sc !ML~nQ[J#Zwr#צZHnh$Iswj(mh)=ZY`}zwJh6{@{lgkZ+өr'X@h,\~}&G npH#7Tk:˴OPukJiki*5WejC@~.w?13]lߤ8 KJ%Xױ#ڀ']IRYۣ^b  1#?uiր4>=ᶇK!}Mp{ sooG$O79WEKtx>H sHԑ%G"TA>j{S*ji|:?;"䰛]mv1և[){?}^Xk_`۵GB ?h@A1$;ww?hx)/hgznpѣӡIMg1諾K6шh51iHq mvMC>ߩW"]_y铷ۉ1Y!Gon:aFj.s ?ܞ ȏfԔ.X5ݩY}q=A UW=@p?wP­;mI" fRaL4#H*;Xֹqi@ͥQZhH=-;Apt}ZӼ?[17c@h& =OUlֽ֬i1ݯdkɉuHcaÂ[KAvMU8mCG@ c/t:N/<,6ۺ?I%xޔ8u9}zֽ[Ytzi;QV i>' lC]:Ԕzlw9oAxDkKwj#3,~w;-G#t_>Ʒ#!=vr}N"!N\/Lf ` JJ^f86{g|Kkx&4rcSi+A2#3Bxh.7ݻ6…ֹ@;cP.sØKA?]w4˄jLIW=[q`1pꩮh9u;gWK`p K;p!ӵ k7h`k2IqRI%+I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I'' )ItҺMs]7+iMu_O Vuaw?s l.:SFpNFUNuJc\k?5-hfxۣS KKڌ}'x$sx$ Kft%Om2 =>Qim6]4Y[ Ն[{}7>81Wav=ω5ηqrk#܃.%p欄@Ai W]_ʰ&Zi@plm@u{6?S -[ZFOh`~z75ent{@a{i2Ųݡ[/$HUc=M{- 8A^ذ{Y~[?HXH{ el6wb#e( &yiGuoSǜ_Q 6oS/Y%on]O1;m7CnGnjL^?&DھCoev~]?ܛn6bHsG{?h6kW;ogK8`l?Q+u:h@Q6-.i]:s`{)hН#V4hoamU=DfSKhֆi ?~QWů;׹ڗ=?z?ο+Vqc{ptkv6#RsbFAM\H@[w`h!%6! Z^Cq=F:߸~9`< CdO/V:T=k<}EZzu; p7Ap{ A"o\'YX @=7u9\@nEE5qMqBXW׌>~}\]h..;XƸ9~w_}?T{,wo&Y`/qlSX u^80@!Hh;]:@tIo[EA^)k,٧u52}/Luzm\9;Qmn-63u[1?Юyk[ɈTw $;S}@Zx)Xǿ, DT>VmƐ{NѸ;{/Ԣ+ckHn{{Ud;qX=/'úv zxswF64;ۿ(=tϒ^:&am-̝gRv$5GpėkcÛLrk@-pzGG&'{aZ\Dtb̳uk}KG? 6f)km3Ag5F >Fc#WP5ĖRmnx ĸKc餃j~cW@\L }-5J}X z}ϣerb^ư<5.6Xtԋ7~ލ[o%x'4+Y]Gsoi $Pi7{6,;}cV-ޝVywm~[ehMe9FZk\?CKW5ZsFD &u>B#v[MKXo%sj4.2{S?q雕*MTS&R:,ʫ;?Ngj[ ~~硽I&#I>;CgIZ +{\Ho}?. 1.5zSz@xkAs _13}o?UXQ׷6˶D[C]k:cXX`U3XzI $82 ooNjFƗ9DzI+ʚ$uXluc8p iw;bU.֒5Ug=S][`K_[>:\v> \}~cQcyhc=me?{[5Z $ c&msli?G oϊج5MMgl@6 \cV{l'`e=:Xѻfscv`DmhY?53Ԭ5wK@> {!|uȤ%-H|}69;\Pn IYg#fݯ~{ MK]XkF=n5EСg3i&xIYάnI\H$ʼKq7c5>O7#ܗ?}w,n}=V{]n^]ov#U}FZ@t Nץ0<{hAR*vN 7W7vG -OJ;f\~*'/V-ugA1̃},hvQդO߽ xkX%?HǮ\Nk=hu.Z郹/g7!g|lc5{,ӄD:08DI$EI$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$CTItI H${D㴊 #T;A{uIHqq;Qt-ik6I;% |fY$h:,Zb'̠0AQ#`vӏI#=M-ln2~jql07nI*V<46pm`1e$ JMcEk xH.Ӄ 1xc"DiR5;jQ̽%.gi;Cv%]?55Wk }A554q%"ac2<'Mn 26Bkg=c KhGw) M #̩!8&fO$Ek81ܜmYǤ"׳{'HܑTYL Lu)<^}1u3<6<r^։ -K?D%Q- j?q'?vփ"5_N] nưC dH=4 $S*/Ν2JU?s$wޤS,<=1.4UZ* L9h{č;~by&O]M7H{hhϻ"$k)$$F)qNʘNH4;sx2| 0$BkZ}FS!ڽɭ^3|J f .k }?{C{0?iq1$'I" vˢ6gHn;H.qԒ$'D$4I$@pԀ@S5ڝxM<CNI H%Im $JKv'w1+KvB?%.$!9dO09`!($:R%I$Μɋ73Eq.oohRL̤I$3O)$Jþu:8h-$HHY$L ΊM;j $2c&!D7cJyI$xs0;QmokOTj/%%/#T'yumMN> `V e)?R)XP;ZFhF[X)h$iS 9oEac@ןV2LIyc Om( $6H Z 7h=, "@ʒm:Li k 4pֺ5L@F 1X PFuBZt09⒀RI&x@x##S68;Q vv#RdI,TΡ.04o4I$I$I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$[Uk,$]aF>+jPFZY$;Odg?V統~\폵Dѕ "v\ݻֺ :(!CIn0]wH![ti=OkIGnjXai@cӖU-s& ?*s\LLH?)g$ʺ2FmkkKK@2K]cq@Mn.v?ߴq>= A3:4:~bj$I[?Ei ?89d0eGo/h?Yp;\LiJNk&?= Nt%ۄdW疗0jܣC1$7s1- up7ݯ}E{t[.:oTh wHjL飾`sMAH$̤3Ƙi'PˉII FK^\<>kbT^6c:1>;= >[l@MmTC[Kıs}Tr'e8 6Mq8ؙo5 ? Y;FAŤ:j\!ςr6Œ@wZ N )mcInZo?Js)kxwofɭeuݭqvN,8Tyo51뿘pb8O]4 %c0`s\ RYs`;jMGIV's\!an,G==R!\{t|cLp4|Ĩ9=I \d9y1`xvxQ$"iƥ.k. # "+1 >\^\mo?Aʹ๻a~C;|Cœ}o?Uofu׷T!^nwgx/ƛt(anyInE @w=MBSI{7~FƷXTp C쮿~z8{t2w?)l<F_#lԁ8JX5l!% ' 3xG'39> Euso;7 saHݧM36g-ݷOF4? ewh#QDrD@RP )%"o-$I7ݏs? BּwC 5 Xwn>o1 &1'~{"\H?` icܒ 5o۽JMjc5C~Eemm~Wժc=2K'=ͬnwF<c3;vsNp{j/>&5M{?ݘ};c~g@jy-%-Kvc}O#I;q}?!c3Y Ӻ6ƿj@湇QBY09 )5ڀ{6{{Y[4_А1 qy}vWwxX.~g9$I'F# ϸqTd=Ӥx$-w$} K<>S89K7?3uw_𔡵0ɗ;#~Vv>o[gOSf_X% v;}oUk}w^}L1=Z_'sZCmͬ :j^O<&? }!O%7ۍXi "?}?2M%q;S۵l1Y kр;@շ~g8ʁo uQKsIw1Ko11 hGJi$mksYHW`È z#^2KC`hI~An ~]FN7s s@sxގ6T*H̃=+w7󻍱l?)6!t4lĆcia, ٫?cѲk0m2$%'&6n'Op{GE%3i*G^36K{=.{JlC5<^I.pv9v[&h@XG2䗘#?˓ %:HiHsu$xi}fPc n:CtMLkiwi>_**>t#~g:K#$JV7I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$ $I.sq'v\NH] @`~荡k"HU2KGp?yek?5hpGLhHO*L/ kF.,ɑ杔 f ,>'HLBY;Hq 1`ϥnF! 5oE"&6;ދ&BaSx.d_oZ;gF<a O} ZKc6^֑-pC:d }lWfoMƛ6\ӹ+@澂˚~Gk+E7lo-{tdz6{a.?(w }Zckac ;*)ss{~&OMv3"ɮ)i ̲~Utd[͵j0G,! Чo;G* C$rq%:G I46k\ie3;IW?sSwO=>qk?gg֓ _$vS `nm}¦7Ri -cCH$JV4oH |I]Qd7X)u2,O)[uʩ#ݼvuo yi WeαCFiYJl3HR[2A,#nL?Z+ ZwqȤw3M% s=oGc[X@1I& r }@%-c?hIMNc#[$_iM5#T4 h$>9{PqKC =ooѱkj\{j,Ʃ,g'W~ߡ_Uڀu}NR[t].&aE嬆ԤɩEU0ҡ>ϲvkcwg ` ??1_}Vx{dowvH~r>p6Ch"lk8RU}h{{LAM^tR}WV ;F铹:781覀^6lnImd }2q(1:$mj2[[{\Ǔ~:l)<;>ݲٽra }}?ёm.{]T ?Js]2uAHYDnL"I$;I ntDnIy|!q?~$!vMX~lg-eS7{U11XƇh?ѳmHus?)'cݸ6dmI+:s?'{Cu ?I^侶`oR79͏YgmMA5W6V3?JZ]fAU`;PCSgcvk[}?5oS>e-LGZiw)?ioʳf܇7ms[3cN=ͱ.-{K}k~W6.!915U{ \J2@u!H' U79?NA,'W ?U֋ ,[Vg?*ٌk; K۸O]4AhnOW@s=fuƴ̰~MϹu[%>S+A25W)5ŌkspڕkC[&D}$1iiRQ;Z/UP!in+D'n}mva԰,,pzNP챎4F88洵7)8QښskI# 5. OH$&MeX,owu9%#G~ ;hQ:^^ I$I$$I$I)I$I$JRI$I$I$I$$IqhJ b5Ie$K}s$h%Ipg|*l|z@Il#H"z$Ƭ5sƱPk]ЉE7Vh E@gOdN'H %6 ,^u;M4I͆H;-MOdn>IR)pqrhH}:<~5Qs$ pch.I*I$].jK@nMT6#~8$?h4Oƒ~1'37ݯJo*`i^f Q*E.[q%p]U+Z[T̴83,Ȁ^ܨfNT;`!ZZC-1{_d N~燝ϒ"h%LkA(HR;$ ?,#0TZ6KYVa5&b|pJg0*/$}!g 4BL6;I;RB䐝$Ӭ&;go}Rpv˻ Lnö@WI$f6%ڸ(5>Or44Q,kɃ )I$i8j{7]=OfjO‹e}1$ywA&R)/GfRaG@ N+CHARRI>) ?D@6{)WA'{Xuz)]$$3cnyQC@$聄@骘`~iHL aɟay35#AۣFRPu# !I5L׹$xRp/2L Du- vRM,J!`v 0hx\MaG0QsZ fO O}&S(H$[2@OU {cIA:`|U)(LOܙXĂNdL<k#u3e~7 H#́J|ƚ)^ߣ*w.k=ÛETj 'Eq=E$Œu -ptDei)4G 3!4+B`h\kˏ#kZb$A]'L4Ib2CTޢA|I$*I1/5I$I$I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$Z g]3&u{t?l3+vFG2kh-$<+Uŭ >/p2LV K ::{}?M̐9݅g^l1`h4*a 3mQ`/7D~ũl%!hn;O𞢍ͪ^.#q7]w\eͻ j}2i1ʈ{rC\ĞZ.{RRk)h-h O)綽 (d6co{DMb]gLݡ&LN~zvV6g(S| wC@s:M}9l7R61JlQ ]0n;F^=kyswn{$ >ۨ~iwG ~Ԑ $#ED}0=Ē<{{RuԍHhi%&6즰 ۹jKs?jNp<~X4Gs\k6&U[s79RK=U&4F T $vNEL!vM͏l¦h;b(a$ p=R9o$qۿvDq" 8Z'Ʀ.?qkH#uH)cq+kak_ư58'֋kAݷڅMm}ẑGH5$4'=>p$hGIL\wR@w?H{Kmx 5̗{쵿v<$.ng[7}&lZMk 44DGM6!) yy$ #C<Ӗ1In͎?+-Hk^Ǿ]wѳu>E=ٽ>Fz:ֱć9э>}ؑi|45*Xц MPq1{Gֳp%u%,˛_^7Ps߳h-nY|M k{m&e淆ji'kcGZ(X[|'(7kͲt?R $Ɉ)}=zbonﱌvͶs7H.$"nw6,ځ`;Z=&2cSEl㬎 kl`NQ֟ƣM{`Z?~9Xcn|6[~Tqlh 97{\$7oնϧ)D>\N]nLۃ n32H~ )zc/h\JV%Ϊf>][6@~W?2VT͆#;-4֑Z3)u 0 U?}N}&@T66kmRdt}'}G'  mQ4z`ɍ ]kD&Zbp 7);.; [ ;얀\IL=6Xv7:UW z4 ?mc5N#TFc$I$N(pi$-^\GG"ӫ5vȍYWu׹oB%պ+sL_o3I'l-u)4K[$0@؍В׽qsٷqDԜX˚4 pM[p?DQ5E`=0{GG6dKN5w Jk\kp twP79/5%' Ō԰c{$XkoĬdol}_QCUsi.@~wGs|~Pkp?1K>'f %&42 uAwm"-͂$$yl{,U,˪~Lд}_eE6K"\=\C"A??itZAN7 A~jO$$ގnx?)g}S=74=Cޞ_?JZ??(}@# $ uXMm~Rm`@ -w˙WZU4}${[{ ٵmBs.Ofqg4>!OpsC@#I$%>!6Z۩Y,?Io =hx.L<W>oBUα%v?ؘ7&[S6\׃?1\>%}b{K#i鋞=qs?Y,V d;~o neNc]uz!.q=:*=KX-E4tI$mtI$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$JRRI%WӡN]'S53\/՜cclp0?Iv>+ 1$bm9<8t#u_`f?[T,ah2J8fV^? /+tpnLZye-:NϮBݵt~]VC:/dUf9S6 {Z Og] s ^Kdf+&};׶%'Q?~ HwPΪ͍{O8&kdv>n!ợ^Y789ć:͇ͥ.mihJlzMu>|L x2u Ω)x4lUv?vKUu6XC[TKU.hh;K?wb2-/Cy k?53zQcIɐ\I$<pi츺L M0˭u^@%WZs}|'`(zݮ)}w+c7IpcG{,VqQu`-74aZ(c@9%4eeKhO3UTZP?l]'iQvA kmW{m66];xĎcieeA- hueRAqpؗeEko֋/{$i: {yB ^ 9'AڱNˬcu;w -!g*N=21^1sf#}[!Z^T #&Ro67%M^ = Y'@P(Ϋ!Gp(Et A/wO%{(P'+"{o5C{&2Q5{?[}UU{v%.{XG}w 1kNyIf7Tq,.9$CGX8VC :?74o G;R]H<ԭ<{ZoP]K+ jg"C_@s?yL3Av5`g?T+ŏtR;Vܭ;29ssu(PeK;9~6Ԫۈ[[^ցm]ڸz}rkI) 9LV@3nբ L6Z?n:ApFBoSƚdO^dTj76u@8Od.YT6C\׽TLzn ..k}G >¢,nC*ixoZ+63wAZl{5CPka> w@:v_N^qh\'zUԴ 懵5!N@3{I_mnEԁ\CIcOTϠ[q-~hK@]o <],Z /cZ濻kb̦?s-gj]om&6wnKOܹ644OMmuR6q+-<5tK`D]{Qrp2ii Uv'nZY4A׾<U/cl~{At?m Ĵ~B$h z\ޝXuʵo`igyoE97T֒@s 6%)ƾ!?OWG}>_mh~Gx2Z<}gԦE9qPȡKVV3ۙFIkpL8nVFK7z:lޝmD2i'X؂ᾗ`$gRXg}ٔYQk]v(3^hiaB<:=6n";$:#@f u {\6KKgqimma2#TVb -&-@KHi0訷!hI:?#dUUt|c=O@pgҷi1e)ms Xƙ]aXj-/kel9#ٽ?F}.x|s&އU, #KpdJmnlovVs`Yr(ߕFդ1Tw7ٱ̀K\?~?IՋhy,},Ȱ#VKy=xm{G!m9 C$5Q~=Ns5NujUeTMokw4;HDq:֍owvIp'h oʛ⶧I"d6LcZ:8Z=Z`iU CE#c!0HOj7]e5a;%GtqcmeX {wz>5d ; vFeV,hhh1}QyEsO/+v y<0u׹&Lpĵ%Bt:dI$)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%I%>I$I$$I$I)I$I$JRI$I$I$I$$I֏J.v=J΅  F"Y I%eDLnVѣg'nP+`cuc %:`5ƪRƴ4OTjyǘh$JL'_﮶K\I4cp6";iC>ĉ!aQ:h'r*\H.peM.WN7r{)I'E\ KߪJZe:QTD4ΎLZ68p5P#S6eA GN%(nm.pwёLedrCx6m%Np$Cib贓X/ \j\~Ps[S"7T4>JE1J%GsZ uRmZ4 `wqƟք+^O "2S>~s2 VWW=pQQqd 7GV%8R $1<|hiT`h y1

SI('c| ub:H&yOuMǙ|+lp!hIL4md^+&604pN)cP3Vf|҈$cYak;@M-b?:ᣄ&]:n5I1̨onS{ߞ;ɾ֏tingF$$O4s!ۏN3J4ok$<D{`$nDNUzMt]*E Kp5c-&ߢCq"A% ̒$['!`AS(I$-hlK|bFTvp7P'ħx  LK$HN%h$|uvd1s!<5GDNZNl<&kc%'lH&CG'H :CIY lLJ SJuZͧsx2#-b|y&t$E2ZFTJ![ckə?ƪ< VI)M:kDiyL us;L}7'p3 (5 ?P4'I&7u)/Q }̥nIJL2+ZR`"\tj[-52v\O ($uԚ+=Z$IŖT)I$dI&I$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$cٗ_0ȏ\њ}B^"L)_kx|Dw\}Ԗp3ָۻM @;`4?Eb@ԕ kiѬMIf ήM̓4`v;2hQ'#=>KIۑ0n`?As`ZB>d ?GvK $Sjƈw_pE h;]ޏX9-Zf&=F*:ZX.svH  pGf|~k\/DSGνXl5]Hqպ=6S/wj\d;3g}K1EäGv sw86N__j-z;vs3-!HpvTyGHf/c5s\YߙzAut3:m{ڛoS}?o?PY, \@}%v u?:$ ] .p IlTSǒ %'!KCZ?Y{en!iukx T`jtLv#wT& ݔݥY]l'4!vHk+1&e߳IƷե_?@5~磌:ʁkw5k~;=i16&|[-tIIo6@kF;zvW[hfx߻ٿCuKgb>#gO$)^-v<4}g!Ş@%6Ǔ >c&[c]?kT]H#YDv8cˬ۫wg:.a;K\~?ٳޢnlve%Cuo5kpoFoN]1[P{`cHsȟ59f ۴$ 6T|}xt1sdn_}c{eƶ ̯Bkr66Xâ_/kzq4*b- sZXyq%c5O}p p?-ijVL[cGW==Ȭ 3s~?_h@j=;#oh{Zo斠sĸV%Kn#K8A$LLpp =72m cdq?٘s@q s?M}o/o"#wAK6}WmL61d9kCFOi Y`ylanȇ eH\qx#IL~0$ 5ݐ/|Xցmoh\׋ˁps] ,[?Vɗ4C[w|I ? bHg{o( IJGc>愔yO[>nݞ-hli]gZ&0 !S"jmɩ:s@X_8k3 3N70\XCN'8- qsE{8,4gs]_5m?MF=>X=mv}n)n(2ƁX=cTvI1A6Ap p]%cX뵡ţM?KO9s{46vk]n0KˀooCh{%k?4mvO@VK) k$8j{n$56T63o5%%~CWi:eNJַ.-, OvnZMr]fORuT׆~p1d}72gjcB}@H4ρ&ڀkZaiYi# O}󄔏| wy`x<O֊ms];1_eK`ϦJfikGdmD-DXCK#Slt8Fkba+H744i-%*` šgh=ߤߵMzW\?G{9#Zܛ1[I;lhwo%~Moc+KFӥLXd7+]< YB+p._Kjsݺ h<h",_i3鹵-._}'ݓSԮA_*.Mu3ssHt䅫 DE'k`B̫۟9X4o#cGk.KlQs }G!G-ō1=~D&_G/.tdGc,);!՝4_~ Ǡ=K#1vpa${}VGMqD NN`i]s"(yioŞjNcsuѤ?iugCavTS7 X v~TkxqEYGdW}`ƍ2}dX@h?zMxk0SSMn#*@/S&~c05m} ?x N?/2aS:t~zYC0ylpηFvo7{m51!-!1DGx9ǂ'/y&\uhc}GA!,rwYD!{sꁉ ɒ'kT=3*-dHqTK.Am<>?#Y Mp8L7vCx?jމӢ[cl@p+&kmG;Ja 939i}u<7BB'\e2[`Th;I9JxGvAA|Vk:Y˱*VM$ćvc5kAn?}Vhq_gOj:=2OHI9sYA [PrtǑ1 εa}Zߢ]zQ^;=.?b&{]m$AԏMg2IH}ޙJVO'qk?w晗z t'3^.}@1 p 6h])=Yy]HQC2#p5=q2eq(yd$'Qn\D}wQ7GqSYWwBP˻wtX, <F<{G܎:e$XvJkmo6OokE[^Zc^zng-۽oa_4<:~X&/xiHd=Cl_sz`J2:ApIS[]3Uڴ~zVJfGey-M5̫GLD>.F5;~/!Y44?$# 0otpZ(_PhqmnUƻsjvec-O<fSh@W>Q3]m0[QXPyl)VMnXj`]nq{[2+ 6 4$Zx9dcMg;XL6O%IIG ,7Chwjn'PZ"=ЮT#ERHp٧I$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I-> _sCo~*LS[9ap=VsKJ%kq!'"Ra$oU5 3~r&ȀNO[l$psqqR\(#I@DA(VQ.|NRvڞƾIr)1.{8wAtJLqh/k{I)΀:+ !EAO?9I}?!{SXkqLt$T"!:P%9.@L6dcMэ$LAAD:,vЈ=ԑԱ -);{AN q^"D7$ Q- \'X$4)4ssSYsdC[JJbn-HKtH׃dCôTv;`ͯ$wϏI.S14k97X#ACeoq$|RRIM{C\/2~Cמb=(,G48)k 6c^{`Kyxi"ꨵ7FsnG}ȩ_$7[ BAĵI5Ɔ4fy߸`t2{$BE$SF;N ڤV@$:.Y%.}ݻ*w5s]X:=kqh R%07k~r|Z긴Y"i2Jg' ?[d[X#Pt41ܢ]]e*J5ΡT5ĝD*A>0HhО~JO <Dh)+ I9q0gnfx*..* B@y$eKqك旴WIp05TI$׹`$+&@gHeH ā SH4Bmv$6<~$mԓ Iᵇy  %%*RKh$͓)mHI=j@ξ*% JJ*I:dw)`:r֞`;PhTI'5ŽN HR3R=?;j1sO- g0 HN ~CysfcT˔QkN`a~T_T͚$[}BA!fIDn@$RF02h {0~ͧ~̵ ?RV)JIASvӠh cAIo@*[Z?q))@NI9i Kd=HٵdXtDoM-QH$yl·h[~IN*/[&"9I&CaA{s'*o-;.I,,@VbUU5!e$II$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$3s2I^q^oX\9^ꆁIڙ5Eq!hmkXL\F I\;rn7?a2$!8@&yR֒ ]F 1È添?]=3) _d`稬PAkYd氉 QM6=.ct[Ioo68"d.Ih>Tx%s?IHȭ\k7CkA&c@ȏswV\}i-J!uiێ6 dwQh2 )j7w#v9ZmZIh_jYD`0EZmIgRkjm7=sCI%"ncHh#Niɒ~*14!ǑS }i%5ۮc{li:> Cu4 ڦsCol6~}c,u4[#} J I#Ȧ L"7l:896V}IcsZ3 ivlmxo7=f}XE~,Jfi?C= x'i(GvG۠ uc{k8Kw~P?4?w*;m4L=hC\KFG=h.#` #B4#S{Z,up조\Fؓ䒒cXz@C}# p2CHpwۻޅmf kHeDI^b!ƽc'󇽞11!86tGSlh~LpuBILSn6^^\t-*P%?}V&7U='gQ,il0;\ϣcCJdmKlTϧZړsۻRD6i{e0jp㵱ma·8t?u%",cKYߤǵX [#anX̺TekB4K!h}v='s rB'V(_wA#;ZmJ5t^DKYG147vo?Gc뢌E>VH{Zoix{!67{=Pv;??2;OC+ iDuul5l%cԳl2ט09ٳ~OV+{HZיx-ަfps 6 TYyl(?ҩ"uIɯժN۟uϪCW nͶI!SO!ͷ8k}bqy !:~q6%$ha!sk=S5w4F2·]ϸszkql.Ec{7~wCS~}m>?魬K}]L4%E}?I|v Bmtzln֏/?KnՀ9˚ ARS\KZQn+=i1kkּYk :nCr Fӿ{#of[?L7XB{ FM%C@ӞG40 ;5I#RCM6sp$K3oW66 u$8>- ]sS7FGcK=2=:w4y0R>Lkk`A}]IyMm8 2a?MDͷ[Ysϧ.p5]r8m q;@.i8on:<}[K7Bfqԏn/Y u>IjKuRJe{7/f3ޭN(s M~n#lC{mV!{47WL6ZvGЩu׽'?F@sC^$%ѯ8IM=  6~qa,q1 ?c=Ū}Ѩq?Kei3 'qiQ ;]䙏B+lmZ6ƐuߩFo9I7G]ù̏s[;-e?Dye;dXI!0?RW>ԍC#OI=qt))V'y|9s57P|c: ZIcu;z:ﳁkAva>靐CO#. ?ښ D@ uB`=5ǫ5k Eϥ昂&CvUJ25̶?i;-hpl#4vC>??1ke/L#5̙Kk̓,SCkO`o7l҆Tit跩-ݭ 13g;?!p,cd!3G=-n%9Zsv~{bH~gnaGImAcplU]-as$A6}:-91}41Ę\icHdw713k];"Uj,ku2CݥA!M%"f3X +7{jvv;eO6,ckl-{]._ߦ2c`s}~S+mHxJ3emI{&)& k#M)#^`A$D/ѿئӎy'QeV1ۨInJ49 aeLӺZ2A .K[m]w#]Fu%-Q^6w$JﲣݠwPZF[qZLK]{ҩ "u澶 XXLOgNv?7޹v-y dvSk4}>މc,%`U\\`KV>\ G\I$ctLI$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$IUk}\`:5'\ksG ǒ8w.L|#zJ(thQ~0>wE@ O C9ZKqV:k eTmXml9Q7gi_&Q'hXb1;]ewE,o5fwT ]-:$"u]I85Aο˭K'ble`1G?[h)q*,?sN^{<9ƦFyrGE?@ԃ}'Cw,Zt`P*`>Ԫij&76$9{r*mzA̤m@ps%@֫@ } q@V'$찍p:B%l(7t-ĸ_ i?&?ﶚ㑫h^v0H$@W8XIv@?+Iqxu*g5CdWuMh4L~zgZjFxpc}vK1.!$FGM^z.i̓4A$]Ue^<6\}B fэԙ;o̹y65ҽ|V~&xqBl][V@T.tf䄣QRMԻ#}t&ǴnCfgY!GvdY&RƮ&C],샅%=W:E9Rǝ4tZWN8u:ValˤF?uw̓eϑ#B70Ɗ@79b籅̱;>}e%Ɲ]z`ue͍w?Dٔ:;FC};O͈};Йx(Bw@t{aFVZya\v';ohЏT~oKZvvE}}8}=suE\nS\冖P@۷kL_Ց8Wú\C[5@0wɾ鴴w)[r'cE?}N̲Xu`7? VZkq '_֭j䆍?DFYW`c;?o'~.rLny-U(Y+5]U?a+*c%Slzll;"I<J`=!,we̩̫6w UNk"ON &̷q,rwbԈuV2bzs M$w$ʱF6M8gV]H'V?@?mIk }JC5Q{8z^# S]YUPsc=O|4΍+xVnl`J#Nsw4P4٦?%:/-'q,qLq~̉gsOhHM8tV>Xk,5bKn:GwXZ@& v0 @Ԥ'(oi8l8K.}'lO_73i5(-v5Yd2p鱗cFOX%oг/iIlۛTwܗizmsnΤwL|fd08!.ΚF-ٝ'ݸ][hn԰:Ϡbfbκk$#-Ohd1t<)8h/iq d-'chUsf=+ k#M~s==ɏOt[2j:YPuZpfw'}Xr2ǻe#u ,_麟$Vv6ܑcߌG0@najsEN/XٱoەvjƏkJ؝ާJ$mtj]̟nm[,ob=xRKC[u14OGns&! Oomjfx-@©>@4fmKegƝzǪc4=6nBIN|:[mt_bzUl2%U8չ1x(y>KJ0H/͝ˋYh@YU]dI$I$$I$I)I$I$JRI$I$I$I$$I |8[= pnr:b-zPĘ9T0k&4 ?@zn) ;5@ӈCIDdH113^;$)[CdI.~E,pmtm O|]${Z <i)@MT8H O*@ ;Y$>$ G ^X&d1Hb"wq$UjH)%c Dclg[SZ!Kux얏sx P)N dƸ'=W#@>[T'li<y'2F洉giT 4@NODIYАPH>)'Ih$Y[+/'S(ec:9!?< Н eklR55Gr\X݄D4))f)p&3<(Xt(ױZ؈6@ihn3)΃rNQJM2kt &k}G<N&'GDDa2&I49>I1S̏I,ZI^@B@Jy}46nwfy CO$S7:5?u%8L؟5$4sxӾŮq8:w(G:Hm$L 9KՂ -h0;X{;9Q:\#oJ} :⅜ {b|Ӂ$ *N,=O`;[Kc.'?wEK 9?'c> *\$pxcu?B.#>0;#^jqI4V[>qH4?505۫w!&u#DT)(24j4G*Ln1" h0ԔdC$hIKiEtIׂWLI]`sF;Rp:h!v@$PsV(#E)LBxP5öL{)t'N9*D ӠZ5: HLu=V62C 1i)HIduI|v/0u'Ĥi04S$}7@"g-Xw g#0IKu.$kP2I)iԽH@'YYkXƃ0\xw4G.KvlpLz QP̓`yJ5 t߮*@A@=L\ xQ*Rݬ'KAK薆4 "F p~ BZJP$PHqh8oHOo?H5OR$\Ia566ĝx$70` JLc/5**T4TSK_KI$I$Mu$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I#b-. L+-K( dD {&|X<|y-l t >m웶 iAo cn[#Sm΂\\ZOOLX Y:CDW뮊LPBsKiTqbdck[dwQYLgO7'=. ;bgCkc.lKg_5~$aI1H;VZc5$@jf ku$#!"F (Zm$TX7|g]EnZ|+]dvpnC'+ѵxs!BHԂT!h%/擨ǾNj*~b7Pɮ7'gbm`-c^t{O3ֳGhZg?Sm/$# @i<*Z]VnX-ӐCL<bv%U+ {Mf~k%ӸCyQ,"}A;s9I |k++seL>{==Em{ZEͭ;cML*P$ǑohbY6k̴oJ=ҰFiEG9-́pk LcTH|X#8}-NKcVMz1Okѵ4 B7dI}D{I[^xI(6,$vsZ|mqsحִdX ƛH>OHӆ^,A{K;ݏRus?Oڜpss <!OM#$D$uaF; Z K]>j*U{ y hl79. [@#]pcI$wF- 3;ID `ݰFħ0lh(fd$ǧ"Aٴ,oZ7ꇸ;4-{+?F׏TLw_gTǚ斀>nOT}A>_&sI*?hsG{G$ֺ["?VMޓCZk0 ;ly7")iK5_PF-}%76Iyd $n 5E.n?I6r,Շ v#5KMpp??뉚\Y9'uQ,mzs'gES U ՈѸp8#NCs7NI.AM<ŅUtslB 88 ԭ&&cokc]U[wm[!Fc~{s?4Gm njk+Ic0?'=%#O΄[;81s1G% hvqlFSMX$?چC찍FtFWtπiI1pt y<U?8q !>'T44'kCA֯w/M5v9):woR-;atsƪd @H Nk'i?c ;. oBesۜǻ\voǦlwб!PMykä6͟F-3>QT{$؏ɀ@hCy'o))#n@@%㴏m?F2ay5O5y.slϯU{k@7khmA:~p'?o$(<O)o/, s@0{}ibV ݷ_L:6Z~s-=kf {=J`N5"8Ci>bxђ";S٣HjNR`(li>RQSClykK6~fѪfPA;]s6+OBI\%v?~-1s ^v??=Pռ<^bHiOڜ Zu#YiRRO ]Kk0L5OKYS65ց K֙iĢY~C":g{E'% Ls@.{H;' >yP.b$[^vö>Fw`ZVʬkG ,9=]~pẐ B8/~Ӡ@c#XݣEl%0Ms/v"ǽAocK}ԉn=McPu!RcM~\OHsH?%O}-`0 IHZXo{[IT86 pݵG;467?+K1Df\.waճH4`c^Zw@<̕#[))(evA_UV9Ѽ@iF]udCZG=.4Ⓝ C_];gty%ec}dc5-BtwA@s,u! DOgi#+.HٹyƆc'cZ}!c?;SWI)Xݔ'I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$Z7Vu-ׇ |JS "M>s6(Q[PY="н)TlS[ - >7Dõ]~'י\,sGdVy=wevKk> ve[!7uKG?u]=ߦʄ0c #k{ :wObqƽh;;z[bK@{3uutEB\DR\늜K2wv[Ѳo浠ZI@Ȱv=!G=9@{;Rk ߑO'dt8]{B<ng(Pn}v3W0:{O ,pvOj^Ā~jXluI$ipx0DX_$p؟+?D\WwMm$-;jۻKE<˫> q4kz n(gXqv6eaՌ'!mqE7x:╀/`Ԁ?ޒ.EEQ]o]~iZ U6 7U%1ۙa#m;mŌ-k\[އsG?Ml%q-3F/kL%6ז%j)70Z;Hiա_!KxsZ[Ob j 66?3LţDz5n#?~H4j`D\vV`w9 .k^ [sOvlcּpS;o*=ڎEd\쭿_Vhk[S\uSo¶ztj$g2gV7 4F8@5-;֙vi9 <ɓHﲛU#Qq2ǣu ˉC=wY(_Mmb ;yh^Z.q̥ͭM7hh%-굤oZ;H8$-5Uy'oF[/q Ե[cN-cmsNǰwTk4Mb.UKik w^W6ɓ%7P&ָ:Loa77~0Ni6{%YW8`O]vKrcsѼ~q :5Ll#cA;Œ?q?1h7g[]`x!{k$r NޓL;is?4LbH{oQ-mcXCZ\Zoz1cYONגKCwK/kZ=wݙ~nm}s" TD; }9M yģ1 ִLȏc\ ۼ$+'S0{]Ѳ*ugr@v~=l hqxkj{?KŦ ր CxH%lmԶ5p ==3+#ԒAIM<4sI600;c9O"XB)Vk%s4}+=d v=-VLqoH=;0H3~өեm<}.BcNԔ++6#+Yu4i 2tGLjS?k?#T`v_(˽$rG[]W1xjgj)5Y^ƻf6ֶdԫ a8~nO18ƿDA H!If1`sm?ڊZ+/-&\I׀LQucchIVOڒe`?S^]$c"FwOwqϧ\ǗdZ6GhYU]@ݠ\K˿{3g1i杠AuQcjƄSMB R*6$y}gFv7-% l'mPam%w g硸: SI9#4 `:=WG_-ߢn<$k??鏦['Icpmf,X&Hvwc,*f{=Ioj7Roئ 1o;ɐ[bk$ɍ)M$`:OBa:}(,\x{-l0^`11Ys"d{-Kxiev_ٱT&w{҂y۴l{vlKeA<(HN 5H 6),ixq}m9<1syZ~6CdTj  R7z?",勞I7Vze;FiԒU|q b{O^ZhpJ{[U d&Ϋ/0IU*`@$7?zS][9._ѻ֩K2Iw,heh : #6dG S wӨȕ$$KI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$$I֧Cc> (-~!΀ O!?&Nʓ[O`Jkq,me?7p+t`nǂh)㺍n:rNM69>5 w4j|I~  :yx;@MQ&؀`~^Nlq_@  ~pR{;󧂔!!G*AD%"! 뷍覸&I$)dM )TosLǎ'ۚ,|^vj0k1i Y7R=)V2i4{:G0?tCuDmab$ ]Y('46U# 8ܙ<}#X kh#%"4\b p#E;i9[^}߷tݰ7ok`$$3A" && )Ǹ{A%*e:R\Ild N4L`' .1ΆO}$isaO9x۬JZZ$~đ’I#Q$oxx{K{]Jn<ꄔP.N~[lZXt18N%"G✀#^$zP?""f[=I?i ˇ%/qDOʉѣZǐg'HbE@#? >5goo]%)/IX?N)VYА8Rt;H#Ӹ2cw$D`f y6 *[Ŏu;~␖WD~)>j41ŠCi%c]OIaOܕNh:yT(HNXH١>*; 49i/@ )5_*t'Mnk.i{Sk@Нx-ɨ9S)$U"n%yiH8w F %]2t\Afa:ʓ\ֺZ"dsA@Z8^M;zJX S( l@`>?bföSeɞ]PCٗ;P'K#ܗO ' 7ub{_ȭ&%%"`;M|?9xB)[C`y>MɦkY s'58e1gA'u$I3^$FFw DJ]Zz՗W{k/;i1~}84:"|ОZK4;ӺVA|twX^l@(9^CM׻q&c~9sXY;WY}pk_a0 cOUcߗx 6d`BKx)Ii[PS5p0H"A=[8w}%hv ,/sc^\׽ߢxnsl$mmc۹pq-Y Jӡχ }nx# R< vi &X>򒐗%?68NE492g{Ѯ&FBs\;~d_g%0?$Ւjg8R:;䒘ńcI?3 2 g Ch6n֠;5YNx k^Pi.sZ}Q4ÌďIHKPۤLR\q ??Ʋ51InZ[kw77Lcӻi'6{u' Tf䨑 J@E{}09c;l}ܱW9"cgu?q =޵d4Xwio[Kpsvˁhn 1d0x;뢏[Kqmqa $#ZZ^G??ҩ>Hub6A;Dºݎk;yt7ۯ{=JzmqԐu=}l@R|0IIhț2 }^AZ {6-.ƍiaEզuC[cΆ%mٿ=C_hQW%?)lyn` y7@-:UvQ2Z!ݒE\x7W2F2KnI{*԰2׼l7w#&~eZ۬.d3NB ~%GfGɀ;Z؂L{ضpqyA>7}'g{CfyIJ?XM%ߦfC 7axs@v1ob}d $~> F[ =54@$^J20\}?c+#X/q-~CfSkmkX2?7l264}OY?jv19JHiq{w9\ nv;p-X{\kHAȕ@c`6c}_CʭviI:_4l6 {`?Iwֽ<i"9SkvLZ}63rIg],O.d<=6=4mc @Uc\ߴo-p ϊI 5}ZͦZ jOi |JK^Skq۽[śýg'~zl;̋-c?o:.dK7]}O7D ks5 -?^HC⒗.WˉH?}=c*YY]I{ƇC 1D<kp#m.1D*-~uI8Ar @]{u ;=mLk nfz1c̈́[ORzhm,e$<omc[T`EI>2U4@#SrJm)e5cMel 6UXshU+rX. J B wCۧ oR}:J2yi:- A%3{뱮wd9/?gsѩ8sz۟cEӤh{mOҬ8qN&zfi ?'#TsGiIK 71=ZZӹ-Hne6S"jk.. xZ\M^ m%IIݸAF*pdOv *Q}mF}TiiZ#iI R52\kIoԷg??UsaqsĶ>%dOS8Q.pAdA9n".s"[mikk=f o'˷pvsF&Eulof1v#XDQ / iibgYqeEXKf-@3qgٜ$5.^Y Ai9= &cmqn?5#!4.C!alnIӟ?}L[VKAk5Gs߷ ^} ſT^ڴ}gq=d{Ϸ4i\>rڂӸ`t5pa)k&B ϣ_~ 5`;`hҾ_VXq\ށp5ngn8qkNB羴^ !{vt2ַasuc#i#}w avUX.q3N兲oiwM5kk\;_l?\rI$cuBt:I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$[7T[&K+ne{8P;/Ǭ=ԡa2p|aYP)estPqݲ8-h/&#PD2b(#X>^5eF恺LݺmFf4N 5COSX6cCc/ypי!I gOB cVE'hu廝oO칬aa2w;ѹ-$3?!\זZGߘSދ[KmsYIP @nQ5C\փ>5!Χ],?-[c-e{F4>>Ǩ:smָO/w[\B >061lgJzZZN;HBehHyɦyi'ݵ&RO˲ݥ8k6hcoK%ۈnw2{A?{  a5 gA_w=;k528*fѸhxh5jp{^^]G?jv~SXgG~a=?$Ṁ2}-w ݻieY臼%wz48Tis 1vRB0,c"5I92ln; > cXhvEl9Xٷ[ =o[6~wۈ=m,; MZO)iSK"?9YP~d?Tw #I}KmsF'5VRݸ8і[b2M^5N5AWi|_Kkws?z >mߺA D%:7Lk+sC: ÚH/\](rM8R;v?ieUEZ8c{BF6NCk-Ɩ{;ǷQPe5ޥmdwo-=l~v84:c4"[[ZAhQ!k`n |R\5Si`ko؉muί+r*TֹC{o,M+sw8;Pv'MK,CHhgI1Hz}L$ɫ:Ml}en5^#kݯտ؍FZ};KCnq/xw썭 Om-kZZ;::~C/xI #C݀u"D多GheEd7U{÷@I'&_"H ("xޭy;pogZ3cyh1v}fIcmiqwMﱢPkΓ"=?g尿ѣH ~p(w @0Ο)Ys=H)^L Av4cmc?)Cvk>ëFޟu4bSMHxhtZ=3tWU4I 79ަ??H &sm,wpCiO_S44 ͸hI}_Y5;{I?3E}VlHR~bm^1cv?p^Zƒ! cK5tUN"|5Fnkt<뤖Y.<.,cޜ1\,Z"k=fPhLN^dss@n( Zwp' "LAC@ NIdXTc??/mOVUfܽN:ES&ni.{}/TrK-ur8CuoWEi'_'ZF&nM AaKtnh-b&73읿i}oC=kwl;lhoP͙boջ{Z#h,z-GM٫Z{Bȭ2y=''aI$I$$I$I)I$I$JRI$I$I$I$$Iַuadts^`g鏒ټ &͕>E  x&pˈv4HQ{KUٶ܄z[ɂfB-L?5ID}D\5$m*[l88Q6My;f|ܢHd:@%( IBPspi:Av Rh<jLkHs : = l&1g>HqtLi?Fdj<1tr{'))'%Z }/s΀ S8:wE$ޫkv}77v>"{( 7?CxK(ju`=?B,5{$ :ƧTזHhPC D)\$1yp A<4,/$\ⓜiykFD="IX4H'H5 đ3I >5Ssa.x(2t~RH%"}Os"gF}n58:Wdc'&al @~B52M!9'=[kfnh'0 ˈ#Q7'Ky9 K!:kSS$ "a= A:#i|jd=>_Og` U/);DSrA?rv%Ν/kI#Cƍt! h$7NM6` kvDΚ1xHAɀ9IVh"a:vMdhe@P,h{#%*FO{I&hh|`8sZ5'Q![^}0ꞒRRPt m$w¨"~"v)9N~B)tВHxq0?? p:wL93o"S2L s<'qBV5D< w;JRuOdE})@pO7Cu &ku_P]$ڤeL OdG09RS0́Rv1⒗L02aB+32T<"X\񼑵6 }IJ\$&siU U'25.ofpOvF-$(IHc91|mӽ h??Y̨w;G0^@NS R p.4Is7@餢e 8obWJ\yT4ܒ^O1!sCOuG预$CuX X# n&*NikFmAZLH$gIײu'4&D=:D[,s4H@HڟJt:L֧S$6?xEP/;ϐs$II$JI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$V065?Gz;Zhoj?^uSni ^ү'{tl(x0r[kr^q?OkX^᡺x֮5x8 GpE6@C|TL7u'pTknǦG媵bVbCw6>\֭>C%i6穷sѱ ?IC{Ih"6PttLxH '*ewz\An)m{CFtkܧc,)${c7ݿc(90ϸ4g?%[]Xﯸ RK ACqߔK ՛*t2c B6/psCxe㼀#7%xv+1kXA N8PeOx))í8'+,Q5fѠؖ@&?~ؓc=Z>wY;;cD >kNOb0icAs?c7gV{qџL|NA3DRR*mGҲk6<[>9cg\fMu<{͌BY^YH7z)QP/[Ai⣴3$qdo4$5YZl5>ѳ_XZ3?I73`$Ƨ_i5y-{6}'OS8N;*p HmgO:."LG$YջoC >~bS;A z&ems͠?Xkb# 06v[K>7{|NNFQ5A=YLֶHt9} o1XAk]֝[cksus@;v>ݷ]eO/ cƻD;14°F9eh%7C#M|̈I)H>jBvs+l<6IXұ c]`c]ZM7hq %ť=K̥H1I ÷7KxtT,wQ/qck-!;klgXXX׏lukGj4Ab5IɃv#|FIlw͐Av~w?MU6_}oC ;ȂwuPw79z` pNQpsGp܈m*V>> ){ykxi?v(}v=60V17gUۋV5 LϷZ0CY =WlZ$xӯYR`qН{ RSfh7O/hX@Owo@{kplOMslw'!IuFu;X5|'Y%0MVliO~W\*u$6UW;h$ 5겶F?z73dwQ$rtny&WI&xdv(edZCI_[4s'{?U\X]Ho?m=5+PKeReܝ%"q4EKiRR0~ˌͭXfN5d{vZ7{,43xsu|{No~? {@v݄? :DTg^)!İ Z?e-swQ {r&I%{v]S %ŮZ>>/ft䔞t q%9 h|L\cT64anL+k|kcn#鱟oiElXKNm%v?5q:|YU:"J+` E0KDgn 'l9F{O/szPiʲWa6i H5HC\@ I?uk 7X#Kue32'lgZ\;@ipJ Fl/}gJ>á;'vnc=Vˠm- a2"Lj5_:'li6bgA<<McPٷsZu3ً2)!ync!b̺-u"%o ;`mJiwז>@lnoIKԇ8`BPF[a@] :K!c$qDDITW8}umlй5>?jYpsM{2.vTߟW%9W a5oһgv5o@$ho'c M峸?& ksHq1 @$;"1A.7-oЮZOhcy'ow[{vٷslak\AǷ_YۅC4' O61Ee` XNk68Ȕ]CYP%V[ POY 6[b uuv&}&E5AsO{?T 톇;5"\ F֓8xoH[H/P\ɚͥ056[P{5p.k+ ynf}ӳұzjN{ s\yXCgݨ'OgӸLif;S>)-Ȫe͛+/2۷c=_(~`yy=_"]m, }=7LVMYup\wzf A>ֵ 0-7C˜-$4_bZ- %2kW]8Z]cgDWa5yP pݿ ۍ!Ey<7@n~g ֖@)}A0ZON%ӼÀNXd+N綠*{~7!ov潣=hfH[__M6*p{s0?5=L]5o}U1aēf˱sqa.ѡ}C~Ds)1ein v?za[LEj7U=hi6\>nD&>) 4A`5%.;nAWW}}{¹o=?뉷~D=:F[~c}V!zXD?~~O:"t* ZƼZ@i ;t|.aEwblԽlBriwIOx6$i7$2,haVHע5l Iw 5ki0)al- ;{a$mT/־b'X66hmX/`Ă@vccs 6w Ner'3zAe1.ֺ'p4A4k$4`ZLn,l%cum9$j z=ehn80 };?H]L,媶v_CQ.kY!O.?IçoX\jz[@IDX(cx]ۮ6>{|^Ѻ}'guu+T=6> hM~!`8K]h`?HwCt(ߣu [St5A䂂- 98oòI kc{ oH;}wQi5V\C;X!X8=@6-vQ^ ۽NUF\ӧd໣jVۋZK;_mD6Q]fi#&E6_AInS$ր};;󠍛}f>GgVn?A\$MWaCq!p`&I$뤒I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I֯@-;w )jì6k~4:by(0^c^yA LtzH TM N?;ZI<F :lW<0~dyuj84$|x];Xt1 LПT F#Od y.= lu!4ÈV nNJK ҉$Ϭ09?& ΧY>JD8xL&3+wI=PcM l!MGԙDŽXHjl78MkÀv7~ D Rz`Ď䠆.xhi&"2{$[*;!|n lwI Ü7k$}+++J% "O.!% us㓠j_`96H?Mn;Z`7R[2bu ?tNׂct7b (¶[:T\ac'Hk$@n )0I.Gj66IHJ&IH'ml2?%06%Zo(8 ti=ӥ )?ah2' MV3 (zF{d5xvԬ=N蘆TDBvԎ5qQ5i15Ot$jM{l5'4]?}%nSƲ0ʷNa=79oޘZjZ%H9h$C'>\ifʗ);u׹*tӽt~V9!]G 5q64;h N@E\8P";u*F8!5q *#EwNV9ZU d@]$LI RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$%5^Hl<.1cKtjg%۱.١?@].0&%scuAw' YWe ?[Ĺ͂ᮇ_PP~XYn] qNaeCM^S[{}1Q֍oi ?f"ѻ{4ߎ3m-yj}Q4D5 97"ryzmwJT]x? N]5`nz:k͍wOrkbƴD}THa6kߓU>>VNyik*89aῚњV+,dczSl Nƀݤ5jXIudN֏{>sjg٩ǍLKP~84:4?݋Vn4TZ̢+secx+5z}lWE%C-V[ѡ-  Xen1ΛpfN= RG(too/=e>H2=Wl9+7<]H;: USWMmֆcI'hwD肘~8c&b?3V aK==9ҷ =v22+=K^Xbu_!gi#lOs2 H.IYFЩCT[[{Uݓ!?\aWw?Y@R5՛~Y{t:!/YܶkarnC͹`NaWH*M:ss:=Xf:טW22+`%LxE:rnH'I_!m> Uq/lΛu"qLFCM }77h]T]Wnͪi{^@O1?f+ 8i*=q2":zvC+qҰo7v1=_$a)PwoVKcfm-o{!61a@:׸ƚ¢ް+sjyJ 1 W1US(Xl4D9)cӻݤ+.5I YE P% l:v[u:j{:@Yk\->}Ɠ˯( b 4?54;r=:b֟_;خ~`[X\ٞUMLE@zv?[UFTOs]Uyck24ڥ__iؠ*b]'MA\s4d SIءmMu2c?Pk}Qxbmѽݧ]Up˪#,Э1~ޫ'_4٘po?KbZM_biDeC }-5 GoCp>}?oa8ܫz > IYJL@1W{NcKK Y5 AZ+h߲lum ~#a҄r- Vȳ ?hy,?R7:~,sO`@#G~\ n aVm$6m?K}z:Ek5?EZ@kD "b?6p5S<aAZ>鰞@ffC2ɸh e&Sw] 8`[/`2wmMX/- cAk-+A9zPhѱ[@ɘUX9öY2*d,.h8GOYs]u8%\7Z6/Dn ÿ_קּaScF*:n]iTM??C^> X'$,忤8S*n CN }oyhXgQkni 3}Eu[ڷPw#<δ0mm,GLqcϲLEy,2%<} .sDwO:)u 8d}J՞0(Pntcy%}&;Kc7٫?qn3O5^Ν\8Ǐh9tcq%b?=}/NnnFoPL(ݛ_#A0t+ mGdu<q UPZ#j0f9V ׻Ӧkz Ɲ$nXc3Ұ8ugcf͌3S;Kh_bܭπr(`46d}C'>ˋkym6{+#18TC%CM{1%@~ Ձk}^w#ХVc^+:hu:ۙ}n;{' 71 9y,m>/Q퍠-PS\Rq\{G}U[ϋoљIo=AUc``+Vmmzq1rX:ڲZ`M˭}F+mycxl"-Zj0ӱKZ@}o]vG*UQ$EbTI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$N$@k]OԺ~Y0_>R俞wX~I<-GXٹvJ(5@$"L:A[3ncD R6iѲIݡ|O 4hcU;xo{ KK6Lc4-nn}BC Dz~ӿgØZۜN>*kg7iHq1']ȏ-x$hđƂXsߴn0架yi=9ܕ~sBL Fޞⶒ|AoK/ ,ȮkͿ>G|Woq ^* { fKҦu[dOכd%eR$H 2q$QN&8en8k['-Ru#ms,!-"֝6G6Liul[.w_!Flw2ûTwK[l򋛣XMg]>{4>*!- p>ECmb6.%lvt~s{q@k l֐]NO/.OOm{k{$}B1o|[?PmA$h#R{4ޒmwl{] 9V*u:ð,F!5qG~?=W *&kD{RM˝ #Wb@sAS/=@4Ci++׽x@D W_@5UXK͠y/n=g) ,6z:w:c'YBvS&f0쬼<lڒH{C ljA{6o؆osC|{~>Z#nP$V2+ ~ c(uwdX! サV+E95G>~c2)|R.v9;ͧS5bլ.usA"&o\www8+gltkCA-&ZtVݼwxwL ),QKc[bvx靈Lf'ɆJyV-liq {K=5SWU~qh޼uepik\Asł/8.eӫxBU|9FyGݵ ¯AJ$Nk)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%I%>I$I$$I$I)I$I$JRI$I$I$I$$Iն%O]ջ=*yM@^ptII`'Qsw"ySgos* 0uYV|btI1)'Pf>iy [ *o7V ˞F#ԗ*AHaǔ?5C? 7"6[q'5?ZO:cL;۪HQ00dDy 4|yf >`2zIR`dJt;D늚YiLӰ5 >7;tNJHy$wbmC)6VO?6KCI1?}%*'B!$S cFhE.ihvKe;\fx?cli<R! gSyGhZz^j0R}\Pt0VD{?zۅ.)4Za;^gRD(ß4:ƿjfYk0fG}3ݵ2=6&>BCfZy&OAM&#/Ѻ%<4-;R١"}ɛ]~%*S0SwJQzf}M5L}k@kX&H{F].ܠAnH 8RRG :S$ Z\NG&yď'IqrHG |4GuaUW w@FL 4P2@ >'MH0N@%xNSNu'l,s=Ikv`69ѩ)`59ׅߕ%3k DTv]4%#SX79рw 6p@h^Jc x9R9n+s˄?Q.lhc6'|D!$ +f $yN t$I D :ۉ=đSh uONhq@hPGA`;6IyvE'J&QZ G*$z$R:hu 5K`:ey~˜Ӹ8IVDxM]ЂCQ{`q${PØ.ѠJ:91IKĦn:h)븏:%Q)rv<6S{i<JS)8=g^Lee?qtLG%.o|Q](8NöƠ:)]#@r*3%:K΂$J铨 I$$H9I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$D{]i~JPqȸ Xߴ?5R !8 [+ֶNy,aө<{si\B ԫ5[-&)X0>EBG?Xf\wR6?R5?Pc~;:ٲq ,fx~7 #U+ޛX^trU 0&1:iIPicOv@&lm_'R`0nA,z!QudS6)6A4]6 A;?x=vWVH7b&% IhԈcXɊKx~ꇶ(7=}og5NlT7Z'?bUZ)O9"mZ q%*k=ZG hSmLC,}욱P_oWmT];nwXg GQ'KPDzzv_9줲~ ]^8 ~H؟HfMht5)Umb{)]kK}@'3赠XM^Z9l{sk>;sUU>E/:7 @Vmv+U^*Aֹ:'_jke=N]8bvAe6$g!mبٰQX}Q@[oQsAsG*͏ihIԶR p/Q>nW;+v{Kgi#>lwCt]`}1Y;ý=1m[d.n5@;5%TUwEDvhwK}5Gn5wwۏ:~뿐YzfX!tk?蓶;v 1j.H-fQ3!ho/6Q>@[ loNڭ<G41%;{;zF]f:O$sPq'#>߾D+q ccL=ȰSiИG[6śu茲qu[CůcC٫k\} GU%ӹt׻C¹ޯ>mH15s{7hϠLɁwھհzAմRs;?3X-6sj+hs;?۩Mq4W&߳2#i93a\5"lAEEohͪƮ`n󿪳fEwm,qVz>}Km%Eejle,?%1h8 yU 􂳆dRpOsX2=k/#BΣ3u,O{q-crUJke1ZVAG"Udä7ӱmxu_mIim-6GKq@ M켫,a4wU(hy 7B 4HRfU j[x-=tQS}+GyfRqvĝq3~ީkMGw/9YnTjdc}feXpotR5jhi?\uEcұm7ӍdD<Oǵf ؕM Eu?ғ~ܟɸ}8V On̥_U-3<ji}@ ?C6[Ds;=ODpU[PݷYƶ7F ܜ`qCXo6˿vM{^SۻQ^E`L~k|yA[k6ʠLb5nꨆeQts@ 6Zۏ.5OJHIiq\´ 6Ƨv%ـ܍m`uǟhnqY.v6Xк=[ A )lB[t:-SSNoEmII$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I:/$toawgCeeۃ~}>RbNa]u06WQǺ& INA<2Cg..qc\״oIM6=c {ֱ jq7Kce#^\ hg ;X]G?G鑹H-:5_HZqDMhҺÚ^7.J4. 8{L?Ns=Cwz=qGHVDNKvˈ~`XkÁ$~lÎZl`~s_eJ"nƺx'~gbV*c`[g%͵ Ֆ'[qzO]q@Ohj薴w? 90I?E C6"b7{9sњS!Ru}z{XiHk@>#sF8kbbcJh& ɤXZZ \Y8\8x=cUkr_dVkʿеtd9m71_@5mzͭxGB&whLj% i,/oa-]~rJ5&cV5>[?E x๲CA;[۵jɰz5&U~wpevP8gJC`y$qQ,[˜F/-8֐ZF {շ^[i0P͹o8(]KXcUjsufk۶ePv++n<}~ÌO=C)^LP;YmzYKnI]K=4 o}Cvo ~}5(v.A?@jv`-nٮH&Z5YMw4 i]{ӺNBaC@S>ô.f$*6X:Z[L#QӰ È Zg,#VI"7 $f}8ic-'I\UuFHv"<i-cYcvyIQ]mZ ,Ӻ}g ђXk`q*rlq.ҧnS-~Xw voZ$+u mNq`4?X r{A% `nl܇B]齅8.>m;Ѷ[D{g-=[Hnp%ld7f[5Ak78tpOjmkHp t%դA:UC]6j\Go=_wYs5V8{Go9fB-"X+s\4Ac튾>8mM c] ]ޓE{M ?C'vʑ Z l} H!xݠk:a%_`S;mO jos27͡׶ݶY k7(#VHw_}MLSg Mq ԑNmsϻvUk7ݓU65g?zW_e- ;lV"ʺn7[6~??*'hn ksIx~0s{kNIQ7fhI9#D O oshւKd)5MS ;D{H(+me5Ѵ̵ۿIZ&}5NCyƼ9ۤO,Zh~Nֽv5{o'mlH;I&\u2N؃[4:ΒϣmNn隣e Owb2*4l1F}67+mn:bZ ZkkՎԈk˜4>fڅ`'{ORGej lg+kOY{#oA+]ǽkW_k\I'WW|Yy=0Y=˄Ps|3\]ךӾH%]7:{T ś,s <dI=I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I-ϫs~Nsx)1NK2bgl./{<6|9bJSJW kiKq`e"a5%ˁ I(K쥵8C=Z$AeJ̙ݮS4|M>)m' %w xQ-xkF5{Pq̝A)`4!.R''Ufv q(9pwmQck..Q}Ih? Gdd*rew`9ϱ7vo` ZH iNmH݁, cޡ}";aÿ}F3̃=#u&; !S A0[E.,>[\_v9X)XۇQR:  , йl3OS$?\"])FRMPak[$;H{$$H IM_43Ɛu:9bt|Qii.C%&>u@?yߘ 5|jI 8tuK›(k5m/$0NIkٱ'F5Cs o$4HXDr9H4軏sƦmǂ H8kv~wBƆNIK=9 %H)Q̀%@%@=pN%kXwBJ`&5J5ʞwRcAcB4#A ) D:Rnrwײj> nuTikP|?&HAHDl:^#kG|ƒY/Zqp\>^_u O/ሩDH'I>-_u9k3'kz<} ZG~O*GD)+sL atZ iv Kf|wY$:\ƈHn𤘉* HUD Ox_EYMw$GRxHR-%5`4XǰqP%=)Wcx$3i$QOt܄3v:%6g1HH1=ԟw`I=4Nqdc IB(gҔI&I$rԒI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$ؑ:abN)ms!܆By}lai ΐtVX\ KXvW?X-qL7-U<>hq7RG4d8BjgIv`3kq}u?-h)W[]m7ّu:Oad}6Є7Z-\|zỻ@7C{kT8)ǼNI鯊zpWbȾKmyk%o;}BCaCʡqi.5'+ƍצƖ0i)CC]LkN+~ )d_VяDlw2c_kk,KLC{6 NvmGY$msu\ Y0z;&ۉ}@jeh 4Gĥv!K:m\v,]WVwEU1m g1@6|v7Pv)Ψֹ)AΥޭ.t@`~j Eu1~\Ge[Y,{^@_Qs:n 餒\m;lh{#K sZ%L~ڣnE̓BVVlxGU iz8pBwT׈<c;)}6!3@cIQF#";!A5YFL=-,~T]ٷH?j'Eu.v3 Nwq`Hrc{{٨s?ͽAK+<H4 gO <1Ǻ5*{kVlVƿ%ĀNw 涾(qDwŲ XLSwYh%FtxiqO2ܭ7ͭ,W Xs[[Oll&zm- $8 9V@;mggUOl0 ISFikA8CgK9i/tGqnA6l'@oLE$͂KH?pUWbeoW¬_i+Dq S5x.Dԡz)(̪:K3^w*BIK @ 26+okkNߥ ,ov?˽xwŖ;nF99xg)ZMVW<:졮TL \>FMԜFOtJjAkpdzխ lۣ@󵧃[l;JI$ItI$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I:xtf"Vf'F5ÿeHWOqDǟN E{Zk C r@ii |yNݴʡwCV`h\v*hpnݍg[lC6yC0 2`[kK{dm>+*6\<@II}l;DN@MZOڧִi 'w?Tr3keI$fIΌ˙S.s[[[;9۽/s7vCNIƵ{09 CgGtn?n&|wDuBk9#c>X4=2=ϹvF5k~?-}V+$1i=T2lmI'[' G?Ĝh~T%ap]o\75Z*CacZZ@>w26l$@o?hTZ*eckҳV˘c"*Kw2a􌖂ف;Y2>SC LC oh *{>X@s4: Nn87k77)[CA?9M??h.{ %uubAF"D3sC9ӯht wOӂ؎<t 78XGf+Xml۠?93R;jf$3W;i 2t"@lnFiq & ڵ!鑷3Ru 4A\ B1\$NLΰVVx|bR>5mC^l|psI ؐiL8mkLIkE<@v{+-d>g_H:1MoYc#Qֿs"PQ#$L~n=?*΢u6m`;{]jX6cmۦקq sHQ488'L`{R/i΁%uc $2 ӏ{lVos_S]SvAaj=)iw\sZ%~&Cas}:!)W@I$fX7hWs!5%5l{?heBC˶?l~{G6q3Z-q~%>ֵ, Aq$5l{i=KgOQ-YM h,s36we"CY$Y{U{MM iѕ4hl6601ch ˌăy I͍偠jKw.6xc2ٗh͡Sv~9t-cQsx5g{DuEysQC&3r#$ 3sI#IJ.46ls'4"(-s1ݷZoWb^Oy$1#cZDo _4OPo/ŗQqk!)u*joswoƲ7Ƨ#訖Cw$ V׵qxvIL |wGmu @h_]P6E͆}qG9Ŭǖ>s!f5 !wόJ'tC cFøĝ#q;Q`ĹUY=k6\Ik<+oS _1.nwoc>6M9%͡+c>ɘ'<{b6G}Kac[Ç=6lɀuI-)%14ni=`=5ZNcOmo?L.5cGd͛SlǺ {tsKnGwobl Efd,'sI)s,3:J]lN{f'>Kuㆽudj'_E6e]Loc[߱.eԶ =7^F>1kߣןWhshD4ƟnԒ4 qq~%ҋҭpݺAhjA_QI$j$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$IֿB{] 5 A$\RI&Z  0ZyD8SPt8V !=㲊A:dKV_;q|?5!2=Cݹ۟.  (K%S7;A_{w~{\* q rEJ&QL5KFS>`JUﰀDh)SA`<4NHnJcY|mF്vrmVù !HpG$GYHNJ% ~8y M9 6ֹ#i#2 tB HƢRE1tg˺g4H=:%􏒈xp>A=o%g#J~5 CpkAsLĢwM$@$ p):5j??II$"<B$5J{ͧ󠸝'_g]sݷÉ)k/q`5i?<`cQIH 5f9I ]x!9xc mi? ^8%RHhh;$׶O?l<5H4ɂ5)D~K%.uN@#^L)YPy{j&0mp4)m l3d>i%pg$SeD8NI}!7D"9}A.&?;..->IKLGv駂#\8&.{j{(ygi ~mLx-%*t6Zd !2`8K<̻?E6 mI=:[) NdĄv ,-Ku6~ddEc;R7ġh@kwNH)GD$@:L7h$'P١&5t9IՇD~"$!F1?P,Hkbyਗonk; H; b\F7f$1^5(aLb"t|bc]qBM -HIKdtR6|5hLL˦ ?D#V4DƄ:ffi_\tk"Xv`%5I+n*xn$wQh/$G0>K1ڞ;DO$.DtHAzgv?w3Q,'P mJI2u0I;o=H(l!4' 97_ wX]e'`_`۵ 5 w{ctD~ҏI=7D%D784; SZZKDσ} ͘caS6FGj ]1L>w4"Iknk`Ρ64#pl!CO5)5NASp /9cCtN''{FmC@{$]DxJ)@?{_L9$|Re'xo3-I)@ !q/1']x\HzWI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I)[E6XvY{[Kl-Ebγn "\G]Ƙy$ƀA4GZӶO=#_4">T$Q~SqqI/@<@[G!EO{K#3Qan]xgJOp8I׷Pkd<$JZN9w!mb.0@m>Sq{ &V[n|N;OL;7ϚEqn?*q))WE,N,BMiw{]F˭cXS6y?D%ĤiD#.$s"y#RJDhc[^I.;Y=l$@{D?5\}|nBj x}?JAiNJ/Xp;!zPp;RSf]{^pު:Ol#YW˟X4-?Uq9Vew~gho4fm0"G.%vHixo&<Sji|ZѹiwoeZkhs]GmmeLz~sv~bMu-htqPq$Kh0'_C^$?SvOIMnq{K_F=e43H??}T.1n{w?'m#]Dz aqv֔lŧ 1|QΥ !IHƣJ MNmM]td{a#GcY,; o!6^֗1~cO{K$qA&$n7n{fT·7!Z%-tojNk=V)  ~~_Zq/hFA[nǨN֘ƣzOla=1>I)u L8þMl%vi5 nvF5W|68}"Ncݷ=Zqsnc@hphe*3騵3s&ӣH<8h9@클ngX`&}>0:<I;FG_6]]g6VXvqPG(AA1 Lj;݈mxIIu mkkթXsp۰XrHw]4P4AOw{NKFRk=#BIi;Lv[ )Uck-.pw 4.py;/oumoX_mmmI FA, gwbLniA!F1'r`Α۟=I |IK_Sy.0eS-0}Q=Ө,8֫h !Doҳ'OM mDwi*UPV]"5&"gA䒛VnKZLJbƷB7 Χ1YX.n&k#OG5m-q I7jk:a~[ rX%w-ySF*W8hz׋{{_Ш6v6DK髱I?kw}-@dLi1: Z֒ 2[$.ڞN`}~)|Hh6?%Z ݒ=?j@߿,}p6Mס~ n'=SU ],H g{q{yi}.nK5?MI?G3 9s`;xɃ]Okn'SAL[UN{^nFZ@ճMnpqsw W3 @s=oسCdsKD ĀI<qQf Kc'{kւ[EoܱEYtƧ-kjhp%c?%NCE)FFs)=I1Qxk-$ڎ?2xNp=w}4;\mŤFlEmT6dyI_NuU=CŻWJ&X`HN\Iw%53G ָI#%%$eP. O1;k^Hj@e ߧhue'>4ƵmhGIS%O{CkC:r?:ߤd$,5sHkkx$95*}}M̑OoBvYuz{Obʹ>" .$9cHw$a<@p㔠 F5C| o)){qk]vnC.9?~Tc߻4X&栻Q햟G*Eq1"yR|cJnS]ߠqfCyb+em &;?Oۿ<' ?P {g9;O~ l~hn}xP4jb:!oȂbG}OQ;=AB wYZgqN?վ, xYnkEMw2S͂׈:\vqG5mxKά.OIٳ{]޺.Hk7DFr$I0NI$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I)SKͅ;Z ^[1XhPz6ΟGe[ kac%Vh I,kځ6$>?B'eo󓩎Ъ;!SuN>{ElV`??_ ~h'pYZ2);E͇.sgN<{w   hk@-0f k;v9S'l{}({r2_[]i-Դ ?ae᥅pߟg}-9:\[ c>CDPc@tInbF7OF+ dM&>54m[=Wh-asqiw~LX?K k"ҨiiqӺvk5!K'ٵ9V$w]*WnfSkX.ht}- +clЮQveh6oۻ,K׮wlc]߇Y}hn6<;$.t7Mr{ A ا̗p Rs4>͟Eh7ĮD560K9gOCm9%i.ѣv'`=L1짬'ÏkKlƐu$u$*xVcjϹz{Ξ,Vϡef#\ F&c"w9Vd@umnSlP/',ђ$Ccklaml &F%hS_Uockk@@$~ke_El"m pukkg*66\5hovVݬ "v]kֆktiv3=H$FߤGևvQ*#7[?F$J]^9NOVL{isֻqk_1V9[e,>{+aOs"&ƇmeM?oCCL7s@Rs#àiReA1۾lm_qI u~b+mkOzw[SPs cCk6}=-H{k. 1ѵ@XX-dSƟ-% `N]cF+ l諫ӹ%Ť"GWoFRƇtwKIؖo\XZSÿ=}?7W"]2/5-ۦO?=o:'P Êj3\K?M ׸5F^V[H=GgP&c97W},enI 4[ѴjppwӰ5n.iiIev{X Oߟb^G=Fz7/"#h{"~򩋎jmv ֱh0Wk&ZC#*Np#q{~G?Ho: ,sEaG5J*7ʩ"@-kZtǿ09V7cAt?o{k&鴹f{ LL|6=}R;i1tX Ux@ o砷sCq{IhsKj?_5ckqcśgt[FƸY}1h[s ,>oFZpk\7"-1 $8$e[ 7jJx'y OQqu,a kIC w~ m/s3vX86Ay;aokۤD1滁7h-'FƩ?kazce 2CW-;f!N&Vw8s[׻Պ2 uA_bOKwTH>  O([ζW!G"zfݜ\ v[q(mqr NߢFwOգöI$<&zXe1ZKk0K^q: 6I`?Y`@AGI7b9 ^{~gЉkGT ll_A!ϴZH5ySϰcRFw3Grֻkd!&ILZ{Fd#aN)+V8}YkG~W:͞wѬOL$Ƶzt3 V 7]Ͱ{_vv)bVז֑=4$մzdn;=by?`O1Gjk{Hh!c+7];ng?~#wV ai?Z#}7ǨZ_5~V<t#^V쨾l-I%3I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$I$$I$I)I$I$JRI$I$I$I$$Iֿ=Z׸}H6!1Nն29:VŦP.-pj$1ÄܞQ`TIO%jvc4]oƴtڎj"?˔ѢNI4蘵Cˈ$ }osOrփ}@FIh?;8D>*PL> 84Ǹjs=I &) pa;N{P`1'. 蒦.Z6+&ql5ęǗ"UdyVHKA2t_iR5 :L"$hxLtc+Z>C../b[" 8%yLlJDA2> )F%c YۻNTZ]̯tV{=dx70#JP3gh$mP ̑ʅuǸZtl28ǐN9ɝ;=Eͱ/!H -%uY ;AJoalD@h"#P (l dH?D@g N$4.y)+qcca[N4GNk5 },JM^x b4@')i%㢐uJkvk̺_IJtę0kbU`yJ?׹JHyqk?4C+vbq2ZKIح%+R)ΗsM}@2uI\6_-hc~{T(ACspФx0FKq4mjJ\$R)6Rpn?%ťTxΙӏ@ٟAAyԁ*aE @;D!w = ?{yh!x*\P0d: 0yX@#!tIE$ARI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$-^q[  ~plqaBpr` mZE۸W]]`0/쮃[ǐvHִnk\~ 9y`M:/r-ykAbuثzc[m9N?űڞ+nvUtn{OQ.u.͟es^\5HCZ1 \4:v-'0XӸխNpՄuZmCpȮ`y :fQQvýrV7OuG$}HGrz)ETds&EޝM}mczw`p1=B.q9t¥O]}x#e7!4Ea0YֳԞrNk5] D?M|Z_ Ii@~筜fn2 }?+q,_/tb,A3XM}YXq\%ASdӍqnoN]+14d8H{7˙Mdd' ˫wN<GG nꮊXt?QuIЂu MBZO*R?SO8ߤTX1SDNpo?]̗s{guX Vj~Aμw7ov6e1ƒ=PV_T,QM\gCIM"DNp6Z־H.u~Tk˜S{?[G7Լl:3MLTG7_k``vM]fUń[~+T[E%h~O#XGF7SVF2i!][e`6sm~6]t2y#!Q}< f3A]]z@2@$^@`cn=.ʶ$@kW6(пoպ7qpH݊M5ciOm_n=sQ#^omy@08"^n+۰{HԠ@Qg6%uJ=;`8sjZU)~$At oʹ-hn[DXj0dO[uRC?7Gi,˝x ;Bz"Z^\%滚ʗIW`SgVP!*M >3mc@WBX&K]b^i'~r]6gBfwc==}$F"{xUFm,Cƛ40z=WRla*-l胬?Vr ]:J]G jl@?UfS2Ho$.n.$0k WypĦuKh:2}=F΍gMoJ"C$uӗFCuw(8"ڂ髶}f[JgQn=>N*0dG4%OjD E9}\}Hv'w?UYDW@Qz 1'T=|#3I}k 3\@m ws[|pH<5e9Vz|V={K~TzcvXݲxܶ:0p#Bnhgj_pwCl> UںF>!|@Ͻ.IwєoNNwFv+[k'=X&Itmg1{ŀգu+S=D4w-<^a>ݱ+;$T0w:,CoMoxУ6?3DvJB/][}?L<6oGG7/Z]O>so#p⅃c1/4<&>+N]Ђ?unB+>_Xm`OZrlOE[S=OTaZ {ݿzӜC}bHS$VGTaGeefN:F?Hg'5@@4GHN5=7n:gL.}L`VdϦVn=IԳmYA *8GԐ Y|tlW#FK\:ff ?NaK mcADn%R }r3g7Z>lkI:gȈ 'Uɗ8ty%ZqD~sCix&)c6UזS {nvnYi`& |NWmz_D=ffWٝ^tIa#FŪY}>ky13{[cbl<{2ԗGkk.{&[ ?qen2v-uskkÁEpc?jdl'S;{l0Z`'pC,dx:V5 ~?Q.ѣ }M6179="Y/Xq{@ v=WJ^X=I5d_O m Iq#qBV2DA,QltD+}Y=*v1Gwwlc֒q3oKptoc4T+߸7{ٻuO#qpmQw# }@Zтdw}ՋqCtoy-Ԃ6S+wN5?{*qmCxe"wms?J3wu])KwT slh﬷ko{D@r6P$:Q%ս|hy64%:cĐ ^ZKwt *C\= OBMw@q[&^'`(k\K "C`$y01ߣK^#x=kYzkȢ?hІ{>K5ʭXV~ /`,s}^kr߶ y eKAG~o!Mq~i O!$LNQn׏{]7z [YsC-oH)7ѱ}$Y]- 0PVkj%dR{tӏ8&?PuvYpퟤc1Mt`6cC+f m}  dXj~ ?QUW9/_MоVQQSfRgF!t(ӃF- 'y}hO1Ƶ0Auxd2ZalOw7ob 9w=|}MGOڱ=&^a$!k?i2\6'OoӵL sb=''w$'y4.OҕVt`!?Hndw}kd?=16c[[fTK{7F#.ޡZY[Oܤ h= Qckvt / c8:4}7+ c-yv$v뢯ڊqvY5 {,~h2aKce.:1UmrKYwΣZ#< !\8Kk~fHrvAs\qPѩhp~-?W}N Kď_{Z̻Z׸ &L w C]|ޚ :=F;Q;k{twLls\ [ F1SGcoU :Llm*[ikՆe9k+g\d q;6?ԭngE9ۣ$›Z`o2_:wICPc]L5hgNZsl4~؁[^q^;B~l?WgXn3^[^Ӽ5?ot{P.2dpnI3&'<V$Y ͑cUVV\؆HkvĜ=]lsnwӺOCeL[k]ck&҉ `ni0#\]Xst$➒\ ߤG$Y*l|\g![^$Lgs{Yyc]0B kX-Mf?̭imvG aLT{TH&G=]j4`psoD,.XwDk ͒fv~)15wC Hkua0yЎOi- sI:wWJew6UcdծjyeMMٶ`R༵/c@#S2:K@ x,#OH/s64n=Qa bA7=-$sN*\{?՚vrt@\}%?EtC4IN.I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$$Im]pXS\;\sGU&>I, Tdm:Cl0ySC=1?{I$ɏ4CDKwAG%8"\uK@lYZ Iw+)7E R=tI}np)p|Jŏ&McR&h6cP  >)> 8u:}:~*ma0SFiզ>#6 c:rߤK$}G)FL''On%S"}3`sAqqB/-0~ R۞3JZŧln)htne9+[&txz^?M;oA k+"d> Q)>*!- GMxc=?o(=Hp>5=sa~j%1}ŭ#Sɍ`SI)6CO&R#HxN99D L ĺ}NoϚCAccCOa ŵ=7kNO͎! =W!-.`N mf@Ru "??Z|4 )c"xFAd$wRRxKS5]'nO*! H-:)7ys\7Lnۈw3ۺ}" ~?t`ɩ5\#*֍Qe ]ߏIJ;Otut%1c¬Z]˒;0Y?R b?*`9yE"4=Qm$HX.-Q@&#I$DqH襉Y//s\' &DޖC1*M{G胛HHa!3@*$kY ٩'F#CM`O?II1+$>Z5'gN#wLy)EΣq$~bs-1쓘W|JV§i}GycHYW؛˼kIj/q` 4?ht mtCLdա|rGEאэO&6: 8D=TdMW}3ǚUcdvOh ,ꘛYk?u T[N.=kq;'f4\wtr.ɁV+X=ǒU^>ϻ22ujʦ};#4<@iCywRh:GxF躑$E`ߤu?~r,9wL϶Tz}";,PD$=%ǃ 7*EmcUx&I/c(aR짛nEG7-nEl#nMjnv0Mɯ:B.#ҭv3݉u; _XJ5U/b_Y%K-&gj ӯcMN$:"@V:;Y{7um {+]KV #HIf5_hG;Y'w*kuBv_pn%?hBGi:*.vAkr/Qu) WKXt6M]N.#=O,`Sf<Pz}mJaMGÏOEVgcןOpͥ78sNzNp:hUMKƻ?td 9'+%-P/7:~TC;|p;Vilw@DzNtsXGn*:?fML ?|CPԈtK˺5#FhK z,1*m-Fġ`,qȰfOb+:i#>h]Bp˦vϼ+C)4p kl>)h5)-e|pMG OOPug@$!Z?G?>NB}5=_K-:y#kipdF_1ؖz>\OXP>WY(]3w;*lSaԎ~k:uA膄ص\=⩃zh5 i T*78TvkZ}yS×x"^0Ra> {:/b;{>pwʀ^Si[krhH1UZtlv@0wV8g do l&O<ҍ16բu+@4{nsCCDׅGY.{D4 kT<6\ V P̷ֳ跲N!̀^d?Y*l?|yYgN6a$ULX·T{] SCk 9-?Ky)FKV%ӛOܛ UG9W5X&cSQ[X#Eg2ԱtH(뛛h?M WdcZ@oEIniq3IÉq1?m8gxMEͧIpD*vtipw ѩ}ve' W(V5?9VW1d~Gm[%%dy Ie_pEj߀UI$$I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$ZCKa$G鯩նa6$4dz󗚶$O >W~3 .<(6U2;Y7ZNZdgcX׾8nsb[ 4v!sĘf߰Hi[X HӱX;w'GsBieNǃUŮ\6ݐhqkHllƻGmЇkſIֳa$~FR?6Z<WH n>0 D ҳ ͖CTpCZ׏:}2dM?%NVeKXlaǩn*,Ŏ},6 7}s#,a,s` #4ncKA@_jg<5Ou'i KxRŮ!lU>gOevב[9\͏2-t5 cFk?3{ҦmT% cw)hp.g$H)zlzgyӟd:$I䐉Xk ;?1蟱J{Ŏ>O6 z}6o9M4 :7]wKz;_UNn&ݵoPg^Dy'1 lp%s@$;qBZmi`{wIj~Q> ns@?'&[UmaIh^sͯsZ1ێ${kk?ј}=h:܏CkKsĺ` ]u$!Ia5;'$1>{0>7LEh19Z ;zieۆEMi:7Pq,mw~qv?Zh]Кͤ9גcuD.$[$YUcs X5YWbuI"*htwO>5֦ncad@phwV~I'>\d7Y{?qḂ4eMtCK{Kd4*`o4t# 3V?Xk9A6e3ދ!&Wb1mw82@}ek dTˬ~AasWg% 8:ӟ)G" v#]:4 ^ k}sc =ϥeh, s kk\m1ۜwbsomm5繌uXSzW`k6#1n4g^Q}"=ĞO?qE2 9$»2}Ն3+i'Z8]5D{@nHń7Zos6As#߾C 3$7[M]0.1ok 'D;U& ˞F ~*Q]ecZMƬncx`ch1DZwWpq.kvdi6ͬ0%qogϦH'l}`G Է;!^Lyka#~& v}3%GIžo{E2P%:9YzԬK5owm^G<7SPhuCNj쬓41ۀn<=h~0s+i9x&GDcU>']/${};͕{Z=0ǹdL{6;gY^Jlol%A?H4}#?Cw;^FC$Ψ=;x},wX*~{IԒ=ͤkX#퟿k(S\lk]v@AugUMyL:gOQ86>C v;51fˎWk9AM@$~hZ-sD5͈!AK;Z#O?#zrB?KѤFdͅ0%8Z_kIt{ј^ֱo{;gc=ۊak8'wDy6~bZ-k~L]Uvr #-e771cM`8wi=_W'@e{w 2w9po-xD|m wНr ?}nn=ĝFlʜFH|czM{wImldqZ։;ӻMK82KO֖鶔9&Z?Og-$2Rj4ڟ62I2Mx6^]ؗto_Uz@s.wlW4HXWYp0{۵osk!W 2}%yaaz[h 흡ۇ28^]c ZbA)q$ %( ̵Gi]SMY[_]KI$rI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$I$$I֟F$8q営>}ormrbD)$S=N% *!v?Ed%|N/F6]D'C?JOiAO;,~}ٯiGV4T4=\ϺNBC]SNꕿh Pvlk*": D5f-;c50L :|ӹS9ہ;4-8tK: i:{!`餥)'RRDiݮv'u-'ǨjvF5%,u%yH2:@BOt\<̍ ڙ}.wE \~|8']%3QkcM#? Oi $K?-bKIk#QG*H,6,'Uh B]h9)1&I*dJ24v8 'I! 2:kWCW?)~ !4>):ؒc^ Nާd;- OɢX)oʋ4j{gh{r~iAq:#?XѼ"_$q:Z9xO 5ŕ b2 7 5IS D0r䒖l ҘL`ƧcZSV%ky sE=ڄ[X$gJ]'LiLs@md0]TZ hp-Eͬ;yvuzq[\b4<7#}E"t:pQm[ȗ]ǻSǸ6AK7wb-xﱆm1?M"C^SIHN GiM; mw<΃@|\SK5m)8LuLI2{DHmkK'k=s@?Pc[=()pvxI R@Ln7Hgd$!O*]č@1 |N$3ƟT>'v96_+7y!7X>-9I'nwS{ΐ<(<\b =&7;Wv>μ(j ele`k$0C`Ȁ=LcG=BsF~g$Q&~ u=ԦTma-ۮDkI%趰}uVXNѸ$=j<'TMY0`Hآj;6HpTi}Bg0ITG).Sk>JVTSˣf2ߢ/7#pEf$ώ(y(7]R0~I7abvQ"-:5+/ o:RhqCuǰR^Sm' Q6CswB ~Ie }Ð'Ԃ$RkNSM}C!>;ACGc;3Sp0"v %h'<0cO#58"vj;߻G䐼 5J)$@0KƙԙH5H#G_K{C ;nL<Jw?90sK=ÀIlLIP`7-?MEkLGw椅:d@kd$fDswz&x;ҺƍkЇxq;q4g tF׸Rr4G:` sg4p8\ƩcҔ$RI$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$.XK;#ݸ8o"F4+?mVv8:K2ƛuNqA#HCcmc xaT 4U?c`HЉ:{e']ix>v犙!8ƾT=GU0e3b㞛pɤna:*u,8 q2h#Tp2gq>:jEM-lWñi) "` "UaX4q]i̡8Ou>1V.e6CO=JߵJvϺ8JĶ I,uy#a0Ff'̲M\IlgQ߂~Sv]tl Iד {JE}3he0e WncqjH¤kpbRr-6F'UC|NMN$tڋ1Krܒ1ݤߐCMt_^Rg-8Pu8ֈ{vهic^N5ͼr~gOEʷR<@5S+ͰUަㅎ*`Fj];bcnon1U+%%7+m GѪUzNJ[-Msr6hiOiNz_PmOɨ=[ e2#TľO9̰wVpxcKudz46ثYO6T6(3 Aydu [03@- mp2Jv%!ȭ6`y)B̚IdI^YKþٹ47䊘j <j.% 仞\1\-.'Ԟ4+]j]eb}x[EMAuuHy:ӣ&+׏6GUPӺ3esxKqy2@mO Qmc՟2We0|$9Ň`w}F>Y.NY:Rn/ Z) AGZ(1hZs, OQ^=fʯ-#G7On>#e]"u&˳t)0YlC(eERo)涱 ӏ}F@5$wR=oZ%ψ3]YKj U|tɬ@R.goXуDk-k-7٣O?Ӭݶjrs%&GV_j{:'58͝n]313s ytp gZ6C8Z=T1'ǟ䫅q{Eu:i~h=Lp>g?{W1>|V׮,^R׺uo`ȣUc%,?Avzu.?*͸Y]{@A=Sǭ/ΙgMqV4[}:&~FK15<UZV\NFٿK6H?y[]lth76I=0nEGsjCtܯTn5\bwtbR2a// RݝCl4Z%!j\4?5^:4HR)^ʓ1`Un@ǒᬃW8h\Ip=Ug18#OHRÅ|ץM DFϷЬUXDi{sP|:kլT3F4 S'*SZ`C@CPڟ^+z}mG?%b,4eLB_a{=t",mVmLkjWcgP$x**s]-Ւ7VhýT}&D䒯SVمtX4&DnVEpyrWT=*yX6ՐhlejeXޙaߛ0L vô22InlO-ſ=P5'R?5Qq4N[},yHQQp> =74}sGn#U\襵}~ƿe%>0#6oO5V0ѯMKm>i(׺iwNF)XP2:ZqX@vnMЫ#=)XGgsDnAM.Q–Rn( jSbc_ȓrv^@ѝb'_kƑ>>{~nC?O){veޛA ؋hx (tGӑhK׿A Pd2|Gc2$k?^66O݋C98r5o<~]B“n㻘ӄl ,M'R}4}lSeC{}C.> qZb4-[-v.Fhk+|U_[\y!UI$X$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$^Ёu %Z?yw|WtwWu$?=5mOT+#X5c顒]k;3B8 rc&]N O(Ltb`=?ڨҶi ;EeļKADbllFlS DD7wGޟ: 8WP`@$1l`vlrEdѓɩ.tFvSXkG67:ֆE`m/"\;ѲU2A-ٸ:/gEٟ cWJÆ?8Kgoc堃GZ.p{_77^YPpim[\v״ӯz;opun;ݩvӠͧeU8Y W ?kt|WV ZZ4kvB k kH*:_f FƹI&vCzƼ_ֶLn,=2ì>[6K\h@l+/5$!vSkw'L '_XKKk^ѳ+Ok1nCI@ o i β;ap <MGpݲ(H| 1[\?b&oI-Qoq1mkǴckUckSys֍[K-ncm7{mMmgۛMo7/ 7w6,'oDi"CH4wki_C-X={mAv5i;~O55olOϪ~%(!Ƹ#;fzi5 vK 9'aׂ{Ǐ?YuyԎROc1E\bb[[6]57Ҷ14uotѲv܏]7=IUL !0Mc(v<k vZjFC6h: >>̳3(600SwZEh[{aSi>w󬮛jǹZ?}U¥۸Z;̤d8Y j\q!N QyXEn$nǻ=y'n+v;%[Z=Բ\̚_UOxoQ?!XD5Ŏk Ckcw̆og}sx5~wΠ C?hl?SK<I0g,_HKi{Oc? jpmeTݢIlؠV$5R,\TksZ\xi5a>`SF ۘA$)R_gG紾r=<@$d4-kczFZeuX1$}=в*i^0 hCv1 H %$$v](Es i;2IlW*vWH?A c= j[ sS7tDIsjTk[3v[z@waw}.۩5hsLo'@5ր'O?Kڼ ׅ`2NָyNCvО g+.L}j]ensnjI$rI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$I$$I-^pֿAnҊT|;iRNA 9EOF L2 Gߢhs`]n" 8?m%, ttq4>)CpO} рGKݻ쟊5Ǵ~kAuti -s5?Q2t!J/s;~j|k{wRh=C!C%VY/O!fJf@& a`k>yQ"C%&o% ??djB~[] RDFpq–9{I{K 42+Z7Hk]? !HԼT` F`uLA 69\K$?CC]hF'ӲO& DKl23Tɰk)M {t@kv}#; CHޛO4}wZƺv ݳ)0d` g7=h{jtL'i#n<#[5 +iy'sm23}MX{&|ʓ$rLPf;Itg]5%24[CZ#_`\8 n3s ;>; \lI ڤ hHG0Q5gUv?艓=6bIR|T,~<)v0||:Q! us#Y!XLҟXRvC~q@jvjױQq,{qBU4kvHN#sźԕ;7XFjs!k Z!0ӃMnO? 07>ANq&àn<ɔ< 5%(`,k@oQ,iְ穹D~aP9_zJb3%3{ɒg;kau?D5:'7o5Kmb76c_R&tOd꫊ϧ2D?EI-Zdx␾>;r͎R#i) j64Guμ]&Sdl\_oI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$gy;[q\bTpY3]X=\k-[˖E\@e$?\#b, 0*FƮN;I/tI{wghDʮqy @>^RY͌`ˌ۳c*L[[Pf=r\9c:^0k`<z]~vCU6vl?w%:Y<5O5[TCtfWCC4Y}Ja2h*nFc{!"%èm҈#_`pmnUfbG+Ac58]Vu,h0u쥟G 7PA#Qh{juBh9Z7 {n:P ˄+y6ӄmz#_blkͫ֬Ǩ幭rI*W'n :>,X܁Ҩ\ۉ'R{z``%ԷXA)h IBf5:^Z5Jπ-vk$uLsSk?ځ~%İ2Ayb7mn<ܪS$8x7ޖHr)< :!T܊Cy X1v9۞4'WfP`&UY!#ԫ;1;GG<~rβzN*)jt;EIq:nfj'@pp1p3q-[]Oޙ M0Rey46uܢ?%ce l5dLhuԴRJ*H)?54qo(tB ?z5PU$+}6:4Gpqfxiꞡ1eԾ5h5SùWӴƊFu9v&Nv^f}(nfMj5pHz@4XHxx>[-eK'JߩDꘞ[FF `!}Buo]ptuPln*;#'|q'^*hYHK;հDӪv}.G =Jgd ZS<tI:}_i &#)vu b<y:Hƫ Ok%:aiPdToB\}+ocRUN~[!ǍFiBZGN1;@T0՗Oo?xNOѐ055/n}#H6?J~kɮ'Z.%u}7@es&cCbz9&H+OE*WXA~b9?D5kߵeQ[q`9itԩuNG3MW03inxOh*JD [pnsfyѫ;N1vƟK'J]>a^q-t<"uNf }K }d~Cq*Cp-g2cɟ-Ur۩ Gt FE2^D YV k OS{v-"{R5x5-PC9g 5 NݵsAuOj0\x?85UWK4mh ;rc$[s/"NQݖLI<"G=?Xk%,]1h6>1tԱW%d[%heOLm3Iz\xЏKOd9u;E]>]Z }B<+K Ƿ@tY(VtF/D9Bzjb {uRt;*h ;S6u('Rlwv>Ug$>_X(c5>H:V)'[b_cy%t;?)HH WeX]dbflx4,fk૘[OI$*I$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I"W"u])e`9\-^cs]>4W@tu>%#+:^OVFQ7NO|wiZ!ǰm6CFDz.TrCT;oPUz%K.ek$/]!ʚzn$l=KfIYcC@ScL>&57k{ N~k h/QUe3ӱ{Gec{K={P;d[Mofi.j.% qg0RsFS:+mz{uZRF[Kml5.ٽF\9Md sc?1J/Z w Gziv y78@gB{O&$I\Z?5#mld]e`5sަTIZ.v6K) n{wzwW[Q p^疆z.}gv]e!>[X !e>3"n-$3U El-sI.KX!:cS&@vpҒd,/ֹۚZ˿,<9̽ 7vԈ=7^Xwd{+c_ϲKO$3of ѩִO*:ct]5 5[aIk]h_OQeͶ =vl$__o6k[J$̆0Ši^\LˌLJ7M \*u }o͢kZr,&}=e4ldlnmomӶ}^~Lv'q_Iqi/h,.ՠ g[OwC% ^9nk}06b}WDٴ6u2 c:5sk='_Ul!CM^׶=ߣ1AnpR ѵ9P54I^7$6hh<]_fzLv8Ћyu+pv ~S]]oWYS݈Kl.$9wjkFߢɡDQk`09n @I-Yާd~ki0A Ol7sb;̢ڬqhv$v\6΀ {.t055qk!_I:ͮڶAok6N{,fip61ִͭ 5)c8 g_Rvh]-u{ۮX&piaD?y.H9$"x\m6 Lf5&^(2w@qp>VlWnk4'{E(ڜllvVIaH'$j֐ li . _Ebk.sKfm=/mt[?" 8V o(d7儃> =l̮IWh59KN ISe$q!3[ ǗOdX+kFᵞ8ъyChcLp{yCpn3wãq[C_"k-%ϸԠ??A~*Iֵ4ly%Yl9VX\eD9MsHpPW*i 53=g]Xu6ְǵbT׶[ai6GSz4O%αIU<i~,2HiT745Y]Mcs~mqwnͭ=U-n;%l﵄{6zuxp ?Q历4<Gz{ɃϹ5쓸`Sh uJ1ucE~b{̼8~o?H/nhj =}{~`8v\ǘ近He~}%-}zz_>خd\\f쏳9Xc~I}-k+FM弄+dMoָ5>5B_Mkfj{$~4 @.D?{EccqIgS#ENݻvoS>=HmMkaѱz9$0's{奔KU6^ hvUGhCA<­~ u'1 sakh@3=Tv,CN:}]G[s*,eK6&nbWcI v'eޖ-BYZMT^Od2 ֺI$I$$I$I)I$I$JRI$I$I$I$$I-^,%j֏H,;\BAv>jI$`=#\[M'lG*a;GsZ%OO/L6YDj<ԓ;A*odY,${Fߤ&=ݯ W~qi A h"`x:L+ kYc+i?Pn5< L'OJB@4*SLܧ!;7tcg't@'k{%G0'_ACژL@{) NpJ_.-ZcZ#A{I>O@wt?L浭߹I*N L4:ǒpI1xMBZpco_UqAN-.o:ڦe I"͉)ZxQA$*N0'9 ]!)ԁ4H|&k l?L\%A Mspt챖8g%}?'Lh(5kI /ksG 'qO{jd}=)|$Z y)0nu=M8t;)^su$x͡[ZN`@0<DŠā#Nks r\mi__Pnq+^Xٰ5$xS6I- U`k3OSm'mIj.1i Fphc%JwHxg$ų옚w^HIײzXrFk֎5$lsjxӒ:sO9IJ2G)DKX|ăp\5yoL :%7]*6ø?PR͓DӞҔ%Xbw8YJl&]Q>ځѢAr htLn5kN'r -0{jv5.=ޑitZ O>I3X5&u%F繬c&9 ^bCnI1I y:$}lip3%g@Ӂ\HwGM%qHI $Ept#Wc6OjhXd)m ‹+kb;wN.9Hĝ?5HM5mi8(hn$[b0mwRRA|SJyN 5đ:Sx;v4c9q Lmp-| .ȗJT7Ty)JD|׷~it84@n(7}'}6LxG,qz}$5`[:ɨ'wHjF!|ObkLGh'XpA+ U/$y)Ua۸ .;cK\AtWgsqAI%I!I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I.۠npd`Wm(dۋytwYsa~KK =#\WӘ+\#_Y_Ps*=+)qŸj`?5W/㧒@}#kc{j׿$c$S*FёWr6v9ˤ=^ށԃoiUL"iŸR7 s?8R+kw:h>U%h \>?mǬ7KԬuA`=ZCyXY;l*_P}q H[.4j%󃒣O_-[nqOZl-4AЎ5c)u?oM=(uv-K!f'25H'},]i:-'6ݡ?Wçg{-5[Oo5uͯ>t*SYNuINe{˶Y['ЭԒ Szf1}u3FOso 2<u =Q5e7zu9>*xmrX4ұXϰbTzvpS07Y ĕ}.GxwiU-ރ݈ Kt۴ic^@ DVTћ:e[?hVUcZk3&'܆[ ;Q`ZK[hbޗ]i\|q% -{r?hZj\KgXjt?).-V7k*w\zkѠ@vP¿Oتu)tceVY~O  u O1%6OIәr4oR?_^8x8#)aWfuC?1i ڍgwZ]srOʺ<ˆ>sz1ùA_pov-Bt2EM^s28MU:q9SamѤH`LF}#..5\*7ĭj27@7r{H?UED #0Vq0h6YCӯ[UD<Hyx"?yFVXXӬzO._xGOKaۉs|+/-?*L5n#H ^1E"q-[ǚӋr}K_/W{]`mӏѣu (]j: ?U\zsA&mdO*/Xh$@̲jDJaRG|vt\ElJW1'c(OϸX?Mm9V0W-s:}1@tSK =d+]aw vRf`;|ޑgO 8NloOj>RWL8z I5[z/C%,>^cȃǿdlqL$:.^:&yR;|J~э\ ~U3Bưi0Y7QvH.p'y7Jh>4x]2&^Ua=;>PtRyw~8y֗OpЦ̷LX 86d5֓.?G^cݟxk}ՃWS ؐ@5$ O;q󍓍==/0+5:~@%D:̒X^/[`7чvEYY&&?|[V1ZYf;MKt%w)-WEff_P\{* 78T$iK2)+xoK:qmu]_'蕝-v~@1YwvCx(%!Ϳcd~O78*%&4<ԗWƓث"a={!C* w95*W׫e5&7!۬}$L˯x>*qU~ :Zrm> TղfqYmuv:eN8`)kY)7Pg F{`X g=? ˳YALN=EWxz cY'9ʑeh|YǸ>}Uè4[s>Ƚ/ F&fxVU8n>*KuBZ~kTh`i?<\kغwwAYTޏV&4*X\̶ =ʦ߁|-?v'Q|^LV)Cntu'_ڪ9'[[ZY3clf!cSuC c>57Q#BEI}\Ѭ*xv]۟U{鶻=hϱcg=ՎExtts\S"WA3zμ,cy䗉ܭ<41)`oӨҸ|<ڭ8pUDI%I$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$IwݍѤn^; bKDECx^,eո@;|CgWrL]c9Ѡ+aD,5,b7x5h5+j$!6_;=DSqdj4\RKptZ> Kv-kFO&1Cv; p?In}Ta#hq} w{'k0u![0'A1Vi.;m{J;$#-Ek=8AafE{L{w{6lo^+^86͘ݳWIJkq!ߜ}؅:ē5_7H1Jnpal7@slm@o k~g3 i ּ]A(Ӭ @&q~w?15<aL8?7ia.pۤm$7솎F=Ғcund?Oc*~~$V?Rs+Smppyw?TR y]h? }?ŻlG8,.L;P[`|9F.M;&IBH"*nosɱjw_F_Pl'];[Un7k$ou8.gKXNfo; ?FAww!`_$²j 27Zk>4?gOmZ}.hYE?_'EOm6> 9GpclaڷnN;.F~7\A7h MГHcpkA IZ-c ,%laiA7%ik7~z7EFthP}=| @wWRM`i&5Z:4:~ ["|J%E6 6팺ے,o$GF(V=FFb8eVDIvZ=VɦUM~c w&9wA1?ɟjE,d(IBsƩi!^{ۄϨCwDkNo=l>.s.۵t~Ϳ[ƲãM_'v055 [6[w>"5%6:Ǫ[7UNsg!-]!9א _I>M{%mVͿ49štAɡw1:~lO$tokё$̟ i+d0k lkXy. 69[_fKys}k~`}i-lw['}YǿX.G1 h|~JvihR`/nH}ڤ&5o|X[;3gjY79ԼO}{H5Z=o {!;SV[cih]g½ARbI._us {"-YFz $MoǨ1-p}v:1gdiǩ'?admi=N nߣm$&]0/t'V?jN'v=Qe,?I}&Jf46{ _;}Xwszf1In\mw>] gFz^U3 .?Iɐ~!9kHs0!JL48AIGŝ6\!ŀ@ XOMSkks-hY?PǷ 5;NOA@s^l[46`x3K`,C_;LgR67ˏaC%Ԏڏs?A׻tl}?1$.p1Q]_n免<킐+lv}h~4_ߵko wZkk,rӿJ1"X'vEB ˇج~)6[NA'_HXdYk۷0:"[KL"n9 4O8.np6cb#X l w}7_ey@.5[vSCl:H0At>)~GIGb,zaQv invK D:\1o~lc5Cw !ynS\׀ 8^YKfZ%?sו斺lAkO8@>ʜ^HsNo]SH"B>1,cd?Gw7V$2I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$I$$I՜ V΄*J!n^&Yb#$[MVG܌Vkq7q-pӺK$^,T$HTQ‘3J\Ɯi|Hh1RaQ $ܜB-{ 4~̱|;!;d|o`"<ܒ'II;hTZZ6uɩ@2AY't6gqA-tTr@SS sFݽ>0QQvց#7]IP :\:{@IO:DxE6Z9~k]wL&CKe;75.=AZC69O ysd|NɘCeMS 4'k1JGJ^$88Su+pqct=Kq!v\:5 4G|]Gvhh:{pK~N/p^=H%Ѯ@ab5v &Ƹ#ɣ'q  !f4ht)Dzk]q:,|1'5N\=I'`"6s>V}Fg_*d0 6JL huXv;?kIhמˇ72= YIT&H$ni>L*uRr@LOwO4kC5LDBpMsGmv+L Cpd{I2$$NJblH@3:$:ܩDp=1(}۴$mٸx LM "Jt$R{Z>IYs\qɏj-chu<ʐXӻClhh0HNLr@e44$,!sI;QH; oGqbZ9ÏKEh> [DD(Y`nr> lc@I#R=<hu5N `̗plΜrJ\Q$II #X-ۄk%Cx[Yݠ-?H<~r`\kp߿bJ]< ؀4hOS4\ aA*_d Pĺ\”o)<,#XE|ēKu6IkP:ܞ_gsfS9V똦CT,r=&*LĢu abVK t X&kM.{ C_RVO< M񄜇:ɴ:TrN]bXx$NӷnV["yt[vet6Hjrז^s*C[q0乨P"<}XÉN??X]sp˯$*]AOӥ]P~4 ن47]`$'!9 s;0.>#:k۴̜ry$wS7X$LEON<z7O~=g!^ am1O^ (qiJvHͼH  s.x81,{he=7!@. vc3}BN}.I)Fr qBr=v?8xJ^ǖi.PU,?H,T]7?X;2d]wԹzuSp?~z]nKSӷtHFqFVAq'8N3$!_+o5ԺVIO`ZKgtoۓ}e¦5 gEڰM;,kvxd8m]C*@-)qꞷn1e"ͺ_؃1wYYVC:柠EXRMUq ?[a~?ڎ%T_,Oz;Roó5Se#A-FVƲ\gU\i1̬r0>mFi٨>* i;)B^Iv2?PpwGmZkC{ 5GnU2Wh{_5C_K}6|Po"<}rMѷPK'O̙?$=)NMTddhw{eG/>X1t \幁[e v0Qkv]bu ڵIsv2L=C%Q'xΞ wznu94^cALi Տa΀Yf`1tC};*Rp44n,2sR6u'կ}6` y@'8Z#-Or7=&wO@юdl;G:5Q[cyt}רWS&ii0 UUp;Ȑ9(O۟S_\#$^ai$w0&#SzVQQΒNcyp:,jZ鑶'k~}]#;V_GYfCۦHYޕ7%ή ahi8i]߼NUȠ=%W=|~@wl˫2/}˩>7GA1X3m&ǀAiql֬JC+4hy}hﶖKkhpgYm a-4#tq44W@%`Jݸ j?M:5u- >UwÉ?R,/sQ[]0t#CRoͤ9 '^mx/lVˤ jƝ&VF5cZ04Ws."`5 ; K?q+kH2<>*]C C!1 AVT^`O(:So> #Rbd*Z6{k|NPnͨ94?D¼iΊA$ȧ{y{Kқ8J[6MD@% =QmN#VcC]ä[3-Ck MsPc4 Vُ[ VNc̈́IGxq 6|3'E;ĿexiogiVd:r􃡣NuC: FǏQƓaL'7\'J~W2k#Ue}dr#^Wh^$ NHz8ӥF0tۼ8K +q >-< q-l\BI =I0NI$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I-oLhb&=Mz&%~Q>kξ]2قt-;H+Un3\g|H2AՀDs N,, W<r5f g=}iP; ΞXӘ1?*!~ZILb= i;ˁ7vvw`e6Z FV*c;n˓XKAhG8-!i=Esq91C_wVVK _;6g߾amX\W?O찺DZ۩p5'bU/54#}치Blwn-o0?1 ӼwۚAA/L-%{@-5}6Yw.qe+;5k^@kZ{{E+tx{Z\ѸNѫRc~\?JCu Ӄ4hIy;Rs"[;7@ѵ zI^MCHkK ;އ{~Ct5kMoEZOJüWԭxi{w뉞L t?DF&%`$[gIf)\uk70ח7gb6(Տm y_o_Rhךe󉩳%5qK4:刺_7և4̉:)kNA` Z;Y?$˳ wCM ̑W*X͵nl{M,õc{^gXo?qZ79sqMV\ZHyo(HO.V)\w8J.mBʚmEkl}|MĨdƏmn䈓~{z{6VXǻv$浍hKJBə;AGJ^^P-RPc{XZ?;ݶ_SFѽWy?e%%hH{_v/rw/!Tx$:pvk@ѦT H>DXkq$R)!8O\CX}=1*u;0)q=HYqkKG{!5W[m14bhY$g l5ed("=.{ɡ͖=8Rۢ}-~m *wYUk[_I?]lg=ͩ׹`#'PZ}BGIhcM0l S"^8`2|OKIn(k㹩u.sIc%{7?=C oߣŎK7<ߣ=W A oi{w"X68BCCy?I$vo9|Ã[/QJ19K]?m_iaAP<1w n.Ygz4s.z{K`CGc?48mn3lilh!N=uF62ָNֽ!Yhqs#svRi}mk5=X4Yi g?e-}yѨMy0Q*3Zc{Med-6D{hIplGVfu%ugs@%c?jbfZ6/jsL{~vN-XF.) ~ZuyWy%ݮ>v?#]vNᚷg= k+!5l1[G_6d ^$x T;Sm,o?ƒC^wm~#ڞkK?ZPAcm588@Z=~}?Ff1lw{Z[uӸճip~f2_``quoc=OMeō'嵇Ag?bf4G-1I-SN&+_a? u6ZZXG}ئkh& ѷFqunnK.?G"r Iu$Z֝.2`9Jxh-`OW]y0R9ŀ8~L,%ӷ3[}Fb]^{zeEh4oq-$68"]ts0bLQh:KBv=iyw>^fߎEr\K7hwC}-u@Ѱ=Oo=N\oImuAsnvCki?)PO aY Ƶ4LIdhtRv)sx CPߢ~zt &SwXlBA^ ?{%M ?:R?q&լs)p.5D/(mcHt$̺)fݤ[±鉿SƼKl-0?s.wHaߛ[AXJÐ$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%I%>I$I$$I$I)I$I$JRI$I$I$I$$I&TΔ?,k,Itt3@-$OOԘ`I&MqG!RY7ݮN/L6bęrO}Aw4RV h-?-6և?vg;tp,nU ISaJbI;?=$5 "@1eָGͰ !!&IL=TJ4DaGb-kK #pA)_MgFOI\dA <'){:55d7 m5p ow{SK~oL Nv%#x™`"^ɛ2g{C+b?P"X\ 8d #tN)ml$=%,[gh 3bv;.wMzI#ֶ o}?*\@ ѭ? i. Y ?D~/,ʑ@g'p#TB " |ӎۤai i.a 55y'`ƇNUT>:\qA/rVf3' i}ILq dЗw/ʓדjp [cx4D F52{Z&h0j>W̤- rS1\_?cAfNXjyac!%5: j֑2S{;( G;e~r.skfu1{C$đFxOPqN {' @; j.EI :8D}h0$0N&u&vD'u@vnji L;`WXڥix?E=;j{R:\4MХ)h4u;yEߤOk~>rԭI`x' i=/%,'] j-oݰZ`iKhf>kŎo'MuI{`΄ LRcIĎcTsa? 6vRk-Ӓi6Kvs`i~ѬpuIxH>$&Dn~d;N 408bq- qǷn#:{q '4)@|rXn/ chu7yp::ƙ5^'?osjLjlW88D#:QdC= 8DxRv3\vݧ?M=[1QhkK˹ U>vyxJ s@ԉwIwk8ĒkNh7Q̤oH'&6QlKwhly3kW$q1搒%# Ja;H#H`)TSƒQakaf[נuE%~L8j;k {Qq כ {p<v}$4)(ԉ a#w6KƤѭIDe`gM@`' wQNu$xP p bFu"Z%|b/w;?@Yk@-Ȇ4 @u)#OyRn.tiO1h`x'Iߊ xKbDDDO3 H2X$dGls,-d괬eGm=sSC}h'`nOE,q ?bVh|Rl?N|{;G'!2t@gKHh2)8J[䙰ȍx[ ܰ2\"|Q.? I$$I5RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$KնwD\R>} ƧhGu,݅ Gq[ -;$-n ZѦ 4y6]|tZds,{c,K$m%'z-cZ\18FN;bF$*05;P`qsvM=omۃ7P󷠒)k\ּ~oz@yf528}AH|V^< ָmErF $cH %[HRDL$ r陔 mkF0}?:,yVAqQɶHkZ]nkcii %cg0`ƤRӒ㤎) .ޣ7l{"b#_O)0ksw lO[EXI;KOg / ǶiMp'O3=ӹv!FtRZcQ:!k\ۿ_Sn~ cٽn\~SnH54Hh~k` A9Š8LE2bA[I  vILC[8ÄmIU]s5"M[.puNCk;8}'{}J"b4?qˋ . ~R6հ!76GET^(Yi7Qq;svv-[\kW~a3vdRwcT'X=rN{A<~?I*w@ ngeH{uqQ5?X{9ܶĪm?bh{ -1T[KF|M3 ƃDBk ǿٿѣdaH>.h{2@el -wњ2DjAp4n=A47򿪦?F^ y?O H|))u:-@6mC}1\4dh j"7)2bwXlD-hoHh;ȝu!ɍ$8*n;$Oy)AKøD865ߘֻO^3@үLsts>7+hq$COu1-Ĵ1> o9tDBK]'}܎],XTZ:a%&߲WVKG'lT̃h}A+=?M^cC6mFϦMuk};op̂HdAM@aXf].J}q"u)v@t {D~{e57: vb6s\5rUM ??%u4$?ݻ*ˎELZ 0 d8Yjo Vh;v&b1Ї=K!6'k7\6_diX/Ihh.`k_kt̟$ OJGy{7א@~N׃mXD^_͍"ZpsY ]?_cMm. A۟IjFcU(hu#$'e4LL.kӟPRfƆ`zo^1ӷC勵׭\K\kt7S³ƴn:i ?`hRd8'ϲM76L'ui$79naMb{I5 Ԓ;?A3;>\L7m=0c5cƥA~wpn1Vcl/7'-\YJU.ZN1Hy xvp#~-^`{qo+0T{2$m>oZ51:.!}s3I "'I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$Ֆ5٭.x^S [Y:>㋅{Z%5u08lW$Y3+1I~-sqm5lɐEgkA?EL{y!>X\LgM?<$;vGA~=wXQ{x4pOX{=&+4cv>oE׶\#Ll} GqZG$ 0:Ai?RXZ4kOwK.>փHqi.7Oxa$5c N+skq ,o2ƿsâ12{sM?4N Pa>;n wmkwޖFuBƾȮH0O+j+XlqhiqׇC 8D;{Z$m;GCy`G4ɜ - i)XuOݴ9'w-kIGRd'cZ\ZwUc~gz-Lm={\LoȘ\?1'5L1Tn%;7, d䒼X sãi=v:7FqGW>heuA-ִc?",tcO7Q)XY5>P k!QF>74Xv1c~g@;۠1.MK @$]BI mmwo#'*V$+\g:{wnu1}3:b|ګqqixkHoOğ{`R $~hZCxv\ h$&RGc/vHw1Bt ]*i S\ԩóly`afο7F| gtok# |xlH\*Q6~s_r6}gN95GgRjsk`uwgoO0vI[6uɧI.=! |\RE쒬\8.~Se~k XoѯGckJrnzoxaikvk%ͷci꿐&Z N^$~,:$eVb ixk&6M@P=~t}z_稊ch;] >E! h^ݬu]-G]1٠lwC#M?空n i *U}_egg>MiZ/- ?w?.}Ow/ht_Ӹ7^5h_6<:x'n']{`S.lˡߓtRAVZиHc}1WX ^oUV/جՊqo.!sL)n69ծ<(-GcYm>kc=`Ev\lli$}?~_P>X[&*slSmn%C~o)IЖƎ<5l"\GTkkZb>J)6Z[Pk\~n/u-FϹpo8Ul9'{lOhwv(Z;}OqdI:;1asӯ'qIu^cvܐ\_)nP-NoV>1h?ᔩ#҉c[L[|G)V@y Y%1xsS>:nױ3V};Ik\;\7mQ*|0Igk+Mq ZG+9v+&`bYf[>0_ۏr:5)$^st~YQܗCZX!4TI%efI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$$Iծēªtp A#I$C1 r#XpXfN gO+/k^ë'Z^;1pCR&Ìtw.a$OIF)I4)G-i GҟeDA~bUhXaLyO@8FegX[R]K3$$k.M/`DhӵU'LB]5˫'CSo[41?Cg@}kO!I_E-kl`i&|\ ॴgT Mc];zh}[NƱuc]~I]IDS5C߽q'_ L4lͳK}%5kxL(W!O"d㹒Ny$顝D4UfA `9Π-< @cGGA,G@?YB^u4NJ UFdH7~l=I~YفovI$v۳&\ꝺhD'65'AUp.6 9ޥn- '^uM5Բos!A?J4 hi*.[1dDw"Ql:G~m7H gZX7; Ĺ=:;[Hա\ ;n^\5"}~ޓX IktH w׬*bLx&SDT,κ$q-k=;. ?:F <ꤐJR;:]Oģxa`j.=b/RR^Ʃ9vk`I:Z:`HШnՠLi``6ffLE}mq; ʘٟ̀j*eftRPtIC >-!0&mƁw"@gr忼.DC&YAD{|ev۠{=A|7~bZf5wqc|G3E$w옓@Ԏ=H&Ei;drc܆փj{}'znsH#wA%.yMD<"FwxF#h D4?kZ]mmqx%p&A4|nH%~8Cy"*oc %8kwJwQ.GecNI&I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$IuUV͌$eÏrELx\@;cƸH@[ NFZv&["t#ܑ%#Tk첁旐G%JeøG~'96s m2#PONg)4~PcC\gH} kjfk$ uL D3,1[N?8~gNfwtӮj5iTAӿhU涸Ϋ.mN>G"Ni\$4;gYPAh.Բ=ݍVF0{0'Y_:d4ZѫgP?kaZ-״~t(ؓߖ:BYʬ ZKhB6>̀dKÉFQ @sZٍߝޮU- [gUg$80c@},s_̪ژ.sAa԰}-۠>usG{].o֫pȳ4?y[wPh~r6AB6cwReuz# Rr 1.f"=SYika7FM'3jSM; GVv6K@$ٛ4&Xɷ2}f\B4d3%?I:!.꧟ٷf5Np0bv/\[}:l4Fݯ۽'0΃9_񋴱bHI=!cL4y|?1VsctڇЖ@K"-Tx:'QcwX#P]?ɳmR'nmWkn:֝d佨b<%d֛csgQd;zsh'!;NԸ;*ǰ5_q-ۤs-߽di^}-:/Ptƚ~VslqG.XO}5,tcBՎC[M 6YU4I=py)9h?D{vF{I]}0PmL(35Y!80Z#;Cc_Te}MWK\.:>N3}\gpyE8v6 uѼn> mkLRC-4~TY2\khC,|4v?D)ɳ+X QwNu R齺\vE8b;slm~jC>tZtFa&yJ09̸E'Fտq/uMtI\ WuoYe1?B5v9;Dn[hmy-/=D"M c/[邧O^L3=wr`pݟ[c!2 Ǿkl;ia]F8>vW` ;vTC[7Iqcz^^;můpl'= λ"=0}k>ciculו] $Y}wƖ>+*2Zڱ]6?܆'t/sM!.)vػ@x$ k lc`f?sc8*m@Z2ڳ8Rf[os.nr2zmk[A5<)oN"瑫v.E8X`2Lď';p#?36 q9X;2n.kZ1+hZǓsF8v2zƳPwKf>?Ը~N37k #l4}/hNms謁1k7N yu^G(uhlaqKkdָM,ՈCtcV0.¯Ֆېon#w7 4z~:} _my(CX5HoUT,fөa_2 |_ `~?-?cI5MedVm~Zq2[߽ܽHC觝8wWQ{Hss[ύHۯ?v&I+Cc ZE'6;&8ndKtXuzsIlgh/ 1o/iSϻYL汵ԏiߍaht)mUb:.͊Ό [LΦ9hTǼL Dnum6٠)BΞ6 .uAcpN/׽F~nϠ}#X3ZtE SncrjQ2>04T+e,i$,f9 AbMtpj\#N)cnh?DW il5GM]pV$c(e8xt?[o<֞u?:Ŭ>eeduCN12:x4s>w{!Zx8+K1rjli絩ӅumgO"Әsih#-zi.Z$ T<4e~[F,\ɮoI"}9gOKuK,wmZ]dtXŎplQEqG;槪gUs@x jdgLnXX:lsabfsr\lgj]֬>KNN#m.; :^%xu1xΤohi ;EMin]-40 ohK_lW􆼷k; `?qID ht: TvtHhm$RU# [ݵsC}ns^uRѵ6;ձ%kLcﲩ}}?ѿgzm4L rKq$`UJKdq> Di?XYAsH͞ p>nh$~ܚt:ּ\w{6.'CCIq:?JkC ugbvVc HOR_aqNO}{[jsv9ډ<v6=𾒈 ǡK,;\Ce~GަKIO3htğ3 Z?=jKA?m؀L,23mkZ7zoH⛶Y\H/3*W\Ѵ5ŦH~ԅ;[S+Dc K(@pgj+h pI%efI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$$I>x Re/$EשI$1ٹ0 U*|ui+&[-ki;BqzPp e@jLxv&qsKcڧk='s72>?r"uا~0\MX?M`,-y H7h'`dCA<䔢N>)i):) ROMI-tΏi=p@w-DF?jJZ$N$p @mu!x$W tH kyxs̬&5%,4:q)8ǚLۼSps}&DI?Q-:G5,miВL F@kH$ ӊu/t āP5i D+B\X Lfd>'T1LqCaNvH{/,{9 󶦨i4!vƐyג:G(.9=ڠCW Ap?5*s\ -䑿ik2  /%lō|<; s!0l5w;O~bp\@kȑ.)][kȝLV 9'F.NysH'B{oVF c!ϱ 1m.K[c\#BE;{Ft?N89 *~5'Vok]\? UZZ_aׄ@s+sIșE%x<po/SCdyDhiuhDP}fX^d~bD q> lsti;ZCdG<4mY[w)8H!rsѴkDǵ9GlPם4 er@;Rnx'>ļhE-‹,phahW1k;-N7VIט8{WySJ&G`G{ cV4'! \d >Kta۝ h;j[!`?9 r5%3ݍ/OW9!΃?Ghc@\<',gHIJ#XE"OoM~)\bL7 64 9csUUwp?SH$O j|ImM ƴCG;#o"±q߽߸Edc3*c;J=w L sHTP-$n؞\nbF'DOcMx 7=݀Sw8sdaH^\c'ǥiLI:%.HJa1;yw:G -h|O洴+J f ƹ3# \24wHGcm-`0Tޘ?osF'F{*$΍#() DytN&6ƣ&IRvȝ`fډ9$kGD"%!r8V@$@x9YpZPh$mO(%ͱ̂LPɘ[,ixg<҉eJK\wCG;KZ;?P\kfL}4I;svm-_ Ƅ!D3cv7@B";(=g4C`~Oa ?сkkp H!08>Toa T u8okH%U̻Q./w&NI&*I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$Imt YK[ }?mt w4O$S21ѬG*ڧSm-;\?gV]`*7a[C~Sˮh:T_Lk"K]#љ\tQA?f!E; oIH'uMl3QAAD7"^N8Tdңh\1*}մ;R{VEo?OC}Rnh0;Pʿnb/v2 -hǛ}FiP:}MApkkgZvMC?DF,ڝ'DM.|Y}DxO@n5Cˇ#'0uc`հaˮ$*ze d>iP+ 6mlQf>'H׶p`ժ@ٙn\>F >؅r+tV_:W6i0+fC29SgLf+Ͷ<xRvG^b;{/(;pUv}Qou~ļԅ`e%Duiw?*n+Zy'dKI[s |W}Hȶ N%Id#[EwǠW]/51]lteVH:`<nX\)*/ǟYi3q<@ꉺȷ;X?14:r-v+gx)UlEA_y AdOѫ z< xyQ[r+Lr'Hྉ}ȏ.۩P}nESSKaO)3 vH43šE^VFXpΰ즬:4Ǘ8}/([llL~oߚ׍?4b%bcu#A 3 K+OWXMNvƊL5ٺM5GmԊٌ:/c.{5[li۩ ,f6-C?%g٘ܠL?w,hFn3gjd4lA}/%'@4_j>݌Zd+zaeAҴIԡ>d3c@:ut#0npꛧ kJLO4uW:갊$aVZ۩KU;ZLLFt4efVO)x>fPA@#e׵qc<v8&>*~16}RR@6XKZLOͫd{5w)c?GQ~UlG=_> (Սk" Ff31\n{}CMs12{_6R@kZ=Of{:f~f!?"̖Z{s0uh'Uwa%'ϭHa!T\ "׍;ս5;DqC>7n^kHש[}-L[K _dnjGd`{=BZ"`<8uj8Mo}VѻF^;;\ʇ&vH1\*uka_,:af#G=ʾ JI[uy:om]CN=p9p+i?Umց1OcrogNWEH#YSAn4#hF(c%0?Ͳw5'slӏN̊sN:7jjqy65NJ]Z׸4Kz%3?FiȪ 1eKO?Ѧ?Lp}׶AeN̺zuD>6c]sY+~yk$@tqtwnP{1~h(Fi>Npq4JB kl6?5u|@>?Af-xi]}?j^j`2 ? NI3g Σ;E95*?|g~0ݘDU >xȰc4{_o*b;#q{UOb^jBیHHS]W]'GN%nK~ԃRvEm}G~G"|즷W?A.2mqpvi}562-88JK\^Dd_!D]FȚkKucm٣1_R&  vFv@n'2@qw@x FΧN]qN8Չs\AsOťaSIt`"'u5*/d?&n5YOދ{+c{4!vKÿ>FFkݎxvR~C溾?mP9=փ>!krVߠcmzN·rJw5m-0:|O 8 +C:Fzv;-~ǰˈCdο}Ԋ ~_KXi5DiGjO~ۛCYu{vc̼@Fk鵑K}osz){] ?fU]M9Ń꽻|%YM,=Ɓ۠wwLwLJ sӡ,vC1dnVnuCHZ0,y;Yλ~飺2.kƿOO4Z꨷ӢDL!HTIp:IĴ Ͱ5Z RI3fwFNMFAGtsKK_ 4 Y7cCZFPOV$~ob@ NknwxAHI,FkYcKm=hv!7i7T6Inv zvޡM5wk=D7liR/ g :!!E4Cq3?\mnKa/t%E&^8?OkˬíU_*\I]ߩ6!4>IJkh$<6h#hps1.lIAh։ܕ\և2WJuFc88~mYIf}q w?hNIq iR!$x;?ElZ4t{ @~oͬ_ [9..EDO)T4$Ibyė:t< I>v$ 4hOZYqH 6E j{vMѠݿ!YTAFlg9&ioIpdѼ5MFML`\,:.A'?F p"?cum$N{@{Iu q46[%?M;a?O'59^;ILq{Zזx6o&!Ƿc\G'  6KXbv7ߝr̮SwI'C[?Qqhi<HvԤV c'ww8FcMLù}ڏ7vO 7;G҃O[/c3ݿο@{=.~ꋌ{rqbƹ-FDs}ۀwoM$6jnCZن;A-mcK}8g]ԅ׍C;Zn9WH_h$ ԑ"XIxIhsEs6 ?HCՊv0_CZ5d=}Mn\`oɆHA)WgkZeC $K᡿vҹh$&bTW{4H@: 3PA8d=r+\H.dskU[[<Ci,̖9xFk6έսba ˆ|5Kę#gc i.v \^Cs$LJ$Y./2qbDy2Aq, ?uSeyqݯcx Jg)tI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I+*Ӑ;MIHOr0:Ko:J%8I0Ȅ`׵v=San.|hx)mlmtQl6ջx"K@ 3?jXuV7| I{;d9395 ThKmP-avq1$h -I+e>I#uJ=v3Y1stMdqs᠟!HU@.@ru:yuhHuI..t{r qZ%۸@.$J -pq;{R#HŠ!E B ct@)6.v5 5wG\hs4#zH\2h8Rbt!*M68 Ol;uo  HS/XptHl|]Xo$LO&8HKDzC UTdGom@2Osd'';is:ٿ(7W49-A 'O~9$! )5 <9pm-dyvK!awh #es Qf"&#6[}@o<c;Mn7BcAs~H?H?1%)kL+djy0Veƒ,!v8 VYc\?5B6ś:'}ڟs;IL>467Ϻwn"neiBe>-?~i${yT&\\ԃqoOؒ=BG*-$N;t088B{K߶rdHj/2=4!%-&`qL'ϒWSsk&Hhi姲f\u'kQ m׷Qemlh'RL#S9]r581u'ޣnXwn;u$bw&'k#r$i6tQCKXC}Ǒ;G/!0<ʌ91Y18AԭGk_;[b\Ya4'ݧK!L 81dqKa!LjE7PlӸR\wm4 .h.irU.I Zӷ]'~2c@u@@'LU?A`6&Nߚ0IoE3C/ph@΂Ω ?zm&d湙6JrhhI ݱ h%p EmݏIErL:hN!&&3clnāɔՂ^j Aw'hQPA'ԯ,scmcvWIK8iBg;y(!3LF4ADNUA;%u{T-C~?><}`3ܟ?i# 0I$ڟjLZI6jGDsoэ{S;[Xs}ϮB)d)Z9L']t(kut%ߺ>tNR/ĒLZx;kE v?% fD ;!)4Oщ>Jm isOmx]p7H )t{'lLg I<3< wP6.ka=ξjEk;q_)b O4S* 2L7@6؜>^gOЧ&:OYMVQDk~)){JDc̩"eOioEMI:7 HZKѰiܒtL[:v>-Re%o23QwsAti$ $Lj;uK [QN߸aqN5 Ů`p{6þΨ)R8=$>968yղ"'?Sk\a4o$O-s/X>ssQkKCmԟS!ʾMYU3>h2϶4A~ɕ̻{oY%3í{d^!Ψ[N>ìv֔ugzoimO$?c)s'kG uQ" Sly){sMsAB鸴4ju .m%`̧-X\w:UZwn>G̮@#OZ5c˽]B60ť:>Tg 1NIvڵ2d,rj7s":ŹE2Z<4=fو^9.{zcj?GvN/\^#*w9XR瞧J2X{OOn;eϢxVMDg+32K-cdO,5Usܰf6å腻^5mv d0ؘnqTԬjt?t_W] +,8md@Or;;VM.UkFrrsMd}7Dǭ7 Ob.?zz̷}kq >qg)es˶sa ړMeKA3v[׵B>ח5N?vt 8N2r(dXIc cVKG撹U!2%6?5QFZcR,1aǮoyl*L3$ k5s q–$馣)خ-cå[sqȬ2;.!ư/#w見RZGp?9😳m=@?6b^[pˁCWCUq!Ju_H:VݕLVf1K"S}@d{Dy՗h% R< ri?,⭔We-&~3Ǡiu=}sslinĪsm wgWA!QHRONʱ›Xd+Va2@ˇ I$%Ht.IWmǨ`KIxh`so;w}FoTrVnx0ѮUJq\G#\# uK1ّ y?+VujA}Gqm74p>ѯM,i;{OM6UbDDhZs^Ai"F%Z}~!."<8"\wSʤ[`+ ,c4jD^*-5gdR̶c F?9Sf&VSY&*gqVqb<n105$Bz.8nSuOZvN>0)qt+%ѿp.qĖ;2O>En} ͊@!oZ$$)֥x=ߟ*~6?2ct#h:;o33Y4՗Ym$3P[Qkrzm74furfփI%;hp(Rjf-hCUd=Vw9ڴvay:@$α5]`Yxȫe0^c_sEic[+mh$`#N=~ AqՀd<8 ϶IĶ457{VfVwp?ګ.DP rGV[C+yskhsCgI.:SFKtIÿSw"W =q68w'ۧn@3* f0 r[Ƞ0jܮVI.ʔ2xCFa> j`ͥұIJ׿HL&ݺ;M #)ٻ f%Ug1 ?hG-t3?5v DDzȻV* HSщʹF}o.kAsȟ?Eڹ|R瞧Y% 8r7V5`a+ca~w6cHtj=7XtE;+hHpەWe_ц+-#}oP 5 C')qTWa{Z;jrKݗ4lcEpJj.mfN0cYٓ߱>0 )nv=vSduYpqɑ:eXe4-aqG_`0| :ޛKC^؃_+0 RHƴK}OE6[6w׀u0=g4'8T$ѬlVkkAXo&ܦan~ʞ_[7qk̬Vd-.>[Ϭ8A㡂<c/Js@hW[<.>$j8BCXq DXx_dsvOO!vLj$;gcYQU /BpݪPt&Gm՟a$4MZ f9l=|Ki9Y m"N?bZ;e6!DdqtjWxm$n3Qɯ.{{WIT+s.C &S38n"mĻv Y@?OWx-ME(z*WӎN`ΎCuCA~-?_Y B;|Ok+|L/OjNoix%}߿oJ^̙_Uj].ga'5y,IP @: Oy睂`2 = mqŻ B|XmfLo*VhƧՔGу[vg d}l780? Rf+Yj]ܓҽ65mtC _Єy .q,-<}qeF^'pJ>P~#8 w{?X"фz\l5Z$;$آ8߳-a$p?,4~ 9iΟz״lG~կ sul8^ ]j+sA{4//tˬ?9e xP.w#SP3A#@G'I4Iu$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$IՌ:EE]@!% H^I$MSg%{ i?S$"8gBZZsCe t !LN[fx{|s!CӠIw(L%K6KZ\uSGR?l{ &.$ff tÁ7\ =V& !2|;(`$ϊ[?*+q7#87oyAm۵L$2$D>*qO5܁$=ct._m .]{hhM97H#Q.$w2&On&]%~bGkH{C{ǂ\k/49FQ Q=Qq`kq$O%Und<@h)v8Ob:$5RKIuOїYhr{1K/'HO}ic>K渘'lzMָio!Ŗ uJp^q"cF7Yq.pD'158!Eh.h\י$CF1DGOOp۠%ߛh亥wݢ<4NLtQq;ǁˑ}W0 Aksoοvj ?}((L󪑔$)ax!}}B$ ޙRk q2y8@$1gy1Q=4hԊCM> Ol4Fsc} $kR1NFJg"gR8Oc\ƖS2u4q J-]$O}$.:s c:) ixրN)#dt&Aw[;. '墕4Hr '|a'@=\87w)y$LDhX 4Lpa@4N'CO5R;9ھ OMcA`I3|H4٨ mnC~plwbX1Ąi92v)ugu 3YEֺe; 6Httn^9!<%=`A:kO]"$G?ud1 hqtD>J#IMZk;awZ:5U~#T*J%=|2P^?P98m RmZD@$24d9-%?EM];̻JZmHH{,F)8Mho> 'n9t ^ǒ[IETto"ef$OdDqwSS~d ۯLkn#Iq*n [I?RTI9ƽ w h5S Lmn_* DIq`r6߁R%1Ϝ(}d4p>ANư )Dj O`RRԸ= @{!kCK7b'cÁHiV͵$㢉xN^bH?$@G$y쒒cY' "I;Vʃ,wpO5Tn`k\Ӷ]F5:OJr] :{'k$ ZhɆ7z9eT`l۲W$#ԧmEkxl{]=pͮDm?JMMRhcSxdp}JGޞI|wbOnC^18'{~@IJ\$}VވGH-wf]oXijvƸǬ74#p!3] 6m~iMXs .!Hﳽ[=kK .2ݟZOI;;-p>D;~dNKYhs@q}acs}emF[g5'0Qͱk~;hnSĸkK}aޝ_>T8;>6I87&4[4>h ?9~چF&CZ;"GJCȉ'Ʃlmgv>:S +$i-։#s o}÷PK+ꤽM?F!!cۋ`74_.cj"~p}vL]AL#A}7ɏM#ކXKN~ %nJ:i{ۡ\-=4*hą'4Gqb[m:5-u_`sX=\`n3F(1i"$Nݷ[Mw$x'sL䤗gNd:#Y x Y5, л-nx>ѻ#H5'4c1A=IH4`"eI'lu?II,<`,cHO?EߟN ts[[ޡf̂`vP/7vָ{vw0v!F89ѵRqȖG&V; fmyD8~3zM{X,\fZ:([ݏcy::X }}O{t'nFꒃ!0Sz T (.cK4-V6o`?OQKw^gF^nsp1m_ I줵Fe'Ȅ8 0 򒒲cNAq:O6-G5׹]T:͌sÃ'oq-AjRh!ӧM y!'yӾ )Bk`fgZS=թ[ oct Tk`'n-*#hn GaW13I䗗M56 .`#Yԟ;&:y:G5'"5=~p#V35INQlwa2k5Ct5Hfakl<;?g筜!hs[$VE} W0f&V[-;OE{.xmt_/ߔ )؋ذ4,oB*I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I)6'^TaFI$R]``{BQ:.<e{t4\#;U9!G9p%-em^LHէqHno|J+ޫO[ Zt9H jHt: ^3Mk@0dߺV]&tִ"I?Q` #)wNViXu6͒t?8g<ӹk]Yoz eR%1ǒx3urKh[i79Bqhc'_9-/"< +mM(XK $hL59 t3uR`{C*28kICL#M8D5*Ns~qz l99k߿AK^Ę(1l顺,,郷Y:~Z{TB?K\),u6{humwMjxZuh2· "TkfG?zAญte;$ ! *'ROMtOkKm%?IS "u.Ȑ uO8G nNv~j9 3o9  x* mq{SӮЙhOuS67壍HA-A"O0AiFoGtHJS=Db8!)7 ߤ?9HOF=|RJ K`D8h n{v4H "?66/~-4j%d&`?萤,xN|eI3gYt'k.8qosxl2{ | %Hߴ-GO夥E U"ci,ccp⚼b_IhqmNJ[@&{5) |xJ{u7@˿ C|s{{\;d2ip. {I!*kwNIs潾"NZL\ A4J%RRB@H!0M;B"7I{TCHn wK|)1G4x1%)11pDk*UVH'nϦV6s\81=C\_)D> ԔyĩZ'!@A8BfwֹķpruLn^4?B \ΠhQ. ƝP-* : Y[-t;]{ؒAHT9tNҀ6VI ԁ `4Љw<6I$yIKj|!4 ƚ&q%'ǟ)ѣhǽE2<=c$#NS6MX6AtD"}D;IS6hD]5aK|?ei)GQ`8h7 u9";?w10~ü_7&5[RscL I0Slα.}nz.'"OxI($IRI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$]Ն6Wϫl/Ů 4kJtwR_K.szc!q -w=9lt6A2ܛn:> &G.H8r,yPKaѲscq;>my4H;\{F"dH6iT? `?IJudspRubXA~w= >{v zMi$jL$#$l4H2IL71ĻIͣ"F0m{Nw!m[\$n_ҫ":Ɓ`qѹӴ3i4Te:GEI.fDj$/?l Kx?GiX57vZ=DkocZ7k>=,ަͮH-xZcNo#HrݿM-I)LuovþHP\n#sFPc 2H=~k.br #o^ IK;M" L<`nۀ X1LQA.AcvCs6a`0gS&7v#O#D{L9`#I/ ;3ػܫ/-xA-vlPޙmnѶt 3$=ڃ߉:3H9R*f. {pMޠXjv-ѴGֱk ?w '!֞dx}%-΁<:H$s,x"#%})ꃬAӬ?o+`sf]1cj&_~a,1nkA{S 0HY8ה$Bg;OPxZA qw{}ޟ}?SۑZAlmݏsN]  xO4EM7C$#Zk$lOlՈgX5is{}MGұg ip˴]mV{M.ʆ晒dLӨ uHLRS67u6<~aM sɒ}Ss՛PD6vȈ: ow'Y>~ Z)=ci 6@hnRpܞ?p; 'Pemun 1~ooUcȒJ/6O\o9CFI,X Sd4ߟg8+t'ſeYv;W-wҖw^w%+upJV--o:7CCl3NEV?y-h^6'VߔX 10 w$2v6 ?I(S6éwc3>#d4=G 7$~,F4`=>ˢ dž5<\h.kHw8#x5ۚ hO_I |;~d7ȕGؠSװ~p' ڈ[ =l|G:d-1]%5gk;wewNw"^ 6:@G_*L,#o?~z"y#}55Lv@(@&fb*b̖84gkw!=;3ohOkX׿Wo).h h ]41 64ylCg ҥ1<%2sS 9o5 wnn@ VƹdA}==kxn1.xq!> )}s6AlJJ^[Z`8c\[jk?]wsCA:#&H3"@̨9gß  ctk'DGmwm5$#kԀ cSqFdF|簍OnR7"tazlzphqI-j[KmVmUZ;xinFoq W4I$I$$I$I)I$I$JRI$I$I$I$$I(|@I)$.Z׷kwSu VLvwLD;t:7zgQQ!e!?S2 m<s?NذKDL$\]`9E(G✡c弟ओ0r[˓l{@>c''8RUKRД'IF1|gK)1?_ #(@s<3˅I$w^=UHn.!݆'!O$;I$H9 1U$I6"4/$ϏZrD$00ANI^5A?w'Y(NۤaܝXJ%ߚ4knip$8p{zr_П5(N!uC %TvC2 wPcYPI$y:$ܺ?B?XN78CLx?nh'd?0v&TˣPѤIG)-( D '2}:.Ikq$) `=')'z'ZbФ57 K!ܑ߸.k}HYF>ݿL*n:A\rWB/ڤ@<F;{$%a%ցjsOù aƥz@1J _H- :hEu !I νq첞_ ]?f?sR=@~H]h) RIY-a`$ 3@0GWVptz{]4}$9$i/x>\HVCI$:Nn 2 (%svmrbn4{^i*QN?F$lN&Lh<̝O#H*LleqٿLjvyBK"G`Ll%p;ӷp*`X{?(~i~h$ D uUiqHcYo:yqg{R=-1$4#S!ELy?5⓵ѳu$'.%I/f%JѵOMIa\LGڥSq=Tt' p:A#>sL7q}jvn{v\׺;IdMɠr:9Z@&_@ѪeϹŭt˼?81Js8 JtOҵ}/r_I0А܌;9Ia _RbGRM ,p\ Oܢ+֘t4}2AoKD/Hg^%<=wO A#v#v鷟'fXn 'e`l0vaI4%YN,Οi\@- xדK6 {"ּDI?ފNTX6< {FFI.mڔ 9|&i&NI $I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I%= !Tl hkfN\Z\@}^cQ3.eW')s&d~ zE5a? P1RSECHƇC wSXsIstlbzgMy&?uk;tH^ZS (# )).e-N&/2og;(α>[?Q=4 `wv2Kܣ.jR 3\CXFdt}=,Vw ֽHb`6\;~k;vh8v'i: RskO?Āi%AKfKH 4¯L >''9cZpcQmuk-#>ӗwxLcfAP%# mĈ8XLǻnB%kx/']>M'uhttg>ϣ'|V.i?~&SŰLwEΞH o:$\C" 6}$6M9]ft~ԙC[H I1?)dZ`GCs)=O$c@qru01)\]w6" uo* NlQ&gQiF$DhtI 趶4~/~NA4ĈbioCáߺmi1LdMlOAw7&{z}0I+9ƚ77Rv7jLusvo<$~s?)SKn͠}ݣSv p;v?Ѥ1S:FvQ=.$1T%fd_%y3n_,;_4F(_\^Zs/̈́6̄yv:x“=Il-yH<q 2m\j5BjjIclHt.VN-Ҥͤ0H')!Ŗm :kV--p !1sZ8~zhusAI:{$ȒuLևΉ;Lx۲׵c48;lQ3Ims@ahl{,J0!{?CjbLJ h 9R :)n֘?RT9Je[ZZߡ,}C%A?4.v'_x8@p Md"OfOh.I_29l/Ce0: H?CcO0]"a{,b%#=1y?"rDk'/kˇ3![`{W˭Oxٺ825w5As] f ąvVI?Ѧ נ?6Zi!NHVs)&aRso`Og_4Kk6eNq:~veB.%ƒ~oLvn拀Ü[TvAƤRe`&%&V t= %eGw4B̀kvQhm G6~C3 ohz7H^AO0h`NG ivLBˉ!TgtwԽ]ѣwpEFG{LY0v)-N~S4{"C[ACptsfLm -Z5$$ZY, Npd<0yNXDNdR:h5IH|OE!pnLHI^=9n@}ޢf`ksGVK)zzi;FTDiBBIԆ4 e2Zt5]Iycp չIi'1;5:SZ$ׂ[DCLX#kAqIK0Ko^P-%/ai!v#Im# 0+Ȗ #@ݴ XZNp}G.mGs{7mzmwu׋=Pݫ0Fo55 >tbZX NS-1NYPXUoqx I$I$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$H$&NvWǣ*mn cmc UGQ[gp!/D/<_ci`jme!l4-O}d%5)WXIs'&/$I&N~Fh-#<~C.kAy'ZFWH7I$k4 J%:+i@=iX;"H>oݏ˙I$ &aѣp Ơ9{*-?|2)$'w'Rt#N!&oHM h??jIW-q|I2tWAhq>E{OhL^ < > juI' E$S^=Gb;e@ܻ)mvPֿK2$NXD0A%E u䅖3KX $>'RI&I!QZe=:o|+s$XǬ܏b$JECԪt <|?ZH N >V޳'IJ 7^ݐPI?g5MH9tĕY:I)샸7P9H[Md}E} :RJOTN1RI$74OqY ]FHim9%$nI$qaݏySK|H6{8ETI%?tﮫy JN)"zO9E$IC A?orD6ƚubwH1 *$J e/8; 8֟vGIZc;$Q c OdZO'Y<2@g_RWEo<.5$I<:72'$خxϦA<rgin'F<|=4;sLL#=e:ubgu0 h3YӺqA/h 8Lĝ?Qi'N L1ϊ/߰8g.gƹ-to$֑agxT}ۚSmN.%-epKD &]jz$CKCcZ&,m.9HQ~O!juP'VGn?.:́aqscZ~E67{ v`dбjuQk$_yטk ?~&LtΧ';Ds[09 `s6CC\ؙ].[-iԸ˜ oɞ쇹ƨtt6߲)=,Zd{uOL Q3˜ oHw{ d5%$.iyn47gglt۴ AZZ'p kO-\xo;?:KA6l$Gu$%!wRJYmeIO\4#R{}?*E6]sXѽ_5 ]5̇Haգ65gi'S3su|p\AnS-4[2N4M>C o{w^unqhw.o1L]v`}q <N[0DcAl#Ne1IIYP- 8eCAoЁ7=Kgk~B6=߽V[8J5Ď9>?H ߼FKuOt4oChCG_Dmgz;umk+@|ܥcl"| -$:5S>& ˃AM2%ӟwM鹮w@"@a S-hI-G9DNjop-pq?0A6ﭵZذ?u5_59#dG'hѧ@PoFO#iM$B =:pR}@fRJi'zu^G7{5 kFn~吴 n\?9f:x-*ү͕&#XLI$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$$IԪ>%:p:cRI$V0:qqI> lhN=hs@P`gj]1&A'l.zf$rAV}>qZ.4 d Y)AH@~' swQ5[:#kx$bgPm`Ҵ]*m2#<<˹QٶZ$MXm.!ҡco!{ Z4ddj5O2!vN"GM@<7o&48k+hGt#INv=B{e+ULiAHdy{(zM5iԻVϺw0bI\}4{ ~j}Dȃ߸ׄ7O!cqv1 S;+;vcC.+sYO.BMZ;_A9M1xS5"xH2.ѯ^k*E4R gOKjcu`gؐ( 2P/Dtq0ن6j&4BL;\x4hV6y t/0? N'y'sAe27i"G{`qG){H6w4: QM d R ^ZuO@S{- (8읜 L}ń5Đ@0#UBm e$DO@ R}Uy г?9DcL~K(2HAgU?RtAk72z;}+4LIFfZf H#"1"e< o3PnwFܢ;쬐}/N$O3(m DyF?/,ݤA!\ALEU0OhU[FNc}5d=B i!<98P_vp|q yejgYbƴ67ķq&2^ O0qU'^x'kZyh-eeݠ2G1@k\iOgRSXtԐ9UM!3nG:"4Ļ#f&)eƀ ZLbEV%% {Nvu>AU lD2F֨/xg^Э? Dk$kZD#U[_>1{S*3%v pƆ_~p88 &IFL*/: :򘝌5KsZ{ËbixiˉZKF(zŚH. iaܓKHRe[ב!$% m2] m2l$'< BE;Zظ m`/a4R%DRJ3%?4 {Z_J}Jk.t i%h8EM|tTùQl#Nƶ!:Mp!$ Q~/R]$"@T;FŜqLk8bQ@b5Ilx (bxM k)Ut1^bH@ w"AN)-IddX}ՂZ92 1rdc>{P֘gOF3nײyB,HZ7٤:O(9YκF(#/2]$Ґ29۸"v`Ҧ+l&!"W'I$X74B x328i*7oOqIa=?/*I2>~Vƫx2}uMh|Hcޖ$'QI$rԒI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$/ ZNWt;?S6[..G6I!\N>k.8Z#VAD|ؔxc]0F/.q.sǹƇ<8{@AAIZD?"5@li3qqa:Ad=C{;C i?bN}!w$l$sKxDN?j.i`h<Nt0>ED8Ɖ)+-yp\;kH#vb}}2Iڦ얖6Vn 0?dCBVLJ>)O5'ƀqAL}=đܝN4ദuH ,=3NӿOzoq>*L.1RR1vеH%P|}D3~&]>#mCqa|lMkL:{#'S۸%EN\grHe}׵kH6ʃMKܧf3h"GJ5ޔO28۸k I#QcIioIKk0 &M7湿D%ΆNcvoLeFnjNlky{H:G_J4sFJ`--xNuJ(k{u@?A1{_p'o7!"ML@'bn&nƆ ` #%17iYk˝9%Tk dnOPƞ<;]s-&O~IհDk$̟v%?4pfGkl9%" )>@cKvD^I vGeu5ZkGx|Rd$j$D0l{ǔ8Y_I[y?=sk[FGg5hH=ΰsw.'5l0g]?R;9Y0X@c6bPDKM%3I0`ޫ--;#Ic=F0b$0<55Ζ0:{ ٍk]]c؈Eplo;oc?k@vRIBtLCg◪I#̤m䐏ѢKvCF}es l?qscм}7jTP` nXbl"vOVH 6jvA(-A%pKC-I;}{?FLe3[p8Խ:A:D}Ls8n8cQ_{{TI}`꒚ϖsHhw5ĿI\ &Ct7{mKyu@[q.~昉-R{\2|0yGit5IlrO%-SiXt;wZGI-pږ\Hk#eoW"Ft:wDusP@$:L!$=M[ӝG#9q$'P_醏6~h ..jNw@dx TX@0 7$a|Cj1{z'>μ>usG8:<B}k)ϻipܛp2G`;pF0yc(K$%+s`w{2Q. Ct4[Fm Jtyuho%x=|Rq>1v"t1L쓨%9GwnI cK\7wͿKz\anSǴ wU~~͊ak31uͽFHq|h!Mx (1AȢm !ƁW4 ~M3}dhG3nwYaca+벫 OoR%o ;uzR}QC᥂ t$Bôn-C|o渚[G?Oڢ܈`i$w>Ϧl[s`}G?ѡoN>x2 TdjdبX.ƭQj$V^ݵ1ԴҪڱhKv.=F`jd44j"51*V]'&BJmf׶;~zFV ԰ۊ-*-.ԃ=Ckis@vӫknc[h$ Di=KD"+9:!Ø ƟIIFU:kG`AUk$[~o/M s>fY۩0[--nS;V.P ?vA%H)e- zL{?~n(cq z~1 xl>~\nbJMY0pe)10"4VCIVS$I!tI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$_I%>I$I$$I$I)I$I$JRI$I$I$I$$I$H$$K/~G ;z~An seYC^Iܘ2;|Dr? cZݳSXk{!jL ·ȳr'_B(, a.:v*Af&Nݵ3S?G;H<S2HI3ARWX\j6ٴ'TapmdhOUw cNAIJk<Šqܩ8 o`1ԏ\T6i-%JZ`T_IAD<.ӼDVc ;CCÛnILZov:G$⟒AzK nQ ԂAl{˃^{%I&t:%P4At?:y<}4qDok` ?i)P'AtmגKKG 5bf?ֶn1EC< !JcdNABy:4YmH'Hokeڸd}77i˚DC\ha8jAL L1Rl4 Ƅ)py&_BdGNZ"k]ZLDmq3=IE=e$ݩ#qC S$aw>؆R*\Dv*.>?'LQq:Gt`pݻS?m+Z+kah&<\kl5?G;l;R D~w f8dDiHJw۲_$GSXG5 K t8ɍ4 )@0h=GIɞ;(i "w[-CHs|&{#5ߡ$lNS?%N;jtOCʓY#Y_fmHQkp I(Mnh$-($οѸ\çlBMuu9ZG$%\z0?jA}"F~$R{ .Iq*_-yHb7)YYelF G0Cv|# 7 ORExJ!9AL.:Ofͱd1?7+ c?h&JOI'2lp3ޚaB ~wS6 : b `OvO4'5)-\;h -X8ORuc]BV=xdi󿬒 9<&>i`G%&{RwegjKmRcdŢ[5YGOG0=>I> 8&lSk}7oXIWoCpcFO.)mÜ|i)y`$;drhZ֞{G- xO0>)ۺ0Iԝ)K8JX;Od03CA jlyѻ`@mŏad$k-dn~{P*TwLp|BN|ԋE89fWſtiKCv?H5iӿ\ L-q^%&R75t:aq$6vZZ$HW8C{tswJL)8P } AK9 H,8EI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I)1 ]զVw]0\^bw3t&ebsuU=]A\ZِѝIpoۋD {&BgP<y3&f"i&6-y/F>^rsfi|x*'+??90paNIpy%1s{?nX?Xpՠ~3QZ!(hAJg8r<D"|TI"9I,mH=h0A&kq<?+ֽ:]gM'Dz[";G95f&`eVi|HX%:d>^䃍nn{{͠Fg)kG8q`G:$j55'ٮcSIH9kki#CL][i::Yv6Gt,cu:v|p@$ ~T 5|쓸 YH\?ns-i';?8q GHJҝ'Ϸ򿖒!: CZwV$m%܂Ni}@[~% \P<"4?"&k3SJMYayO Q5٩sv6ԫköIRuF KoSL> ,fBYÅ v5h59%"moͥCDp),kq#96I3?Gc_Lvv:iMlI $9%N:_ux,uܭ؊4l6?{TEVZ`hG?Mֲ!kѷhhk[%l#Tm hOu5KΟ$~`"m[ Y]~gqq;$߽M5S ?;?;u?Jg贙>`80{iAQI)[S;=LD7Al,mD4K@oh 4 sg%64adU0ѡf&S[NΝbt2$@Fyx Nݿ=ߙ>3aշs6 ."@ke?Fu?u7stFԟ[Z}'7Zc{!k^Ω)˝nRc2˭{Gֺeۈ~4Au$l䃻n5hA $KN4UAtNTM4$6SaaI@?{g4J$qq1sĸ`?icIsx5Gþ$}h>zJqRL&:CA{dzu>2/p[-zgz5sÉۘk,i$ Bw` Hh!!i IZ3ZKCLwG>,k@'Q}'ՉXCg>;Z9!=ms\A"2b\t<I9`D);]b :ʅ{2v74-O)W/ewH:m?Fw4GXm>8ȝuיk2?J$|js-K81ޯs=lV$HtI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$_I%>I$I$$I$I)I$I$JRI$I$I$I$$I$HIJL%t8 UӏjW+in@܂\%HoOE!>uN{!f6|Qkj|]؉L9䑤U\o0=W [t%KЗ/c&cB% Wc պ|M]k]Y2q, i_jkZ=%H1 G1!ǂI%v@ '@n챛O{i-0=Gx׼}6; ;1 r䤙Yk'sqiБ^jx!L~Pi}'G\2N!c٭" ժ:Mv Ψk}ڂ~*F9xxRZGa T2HH!3c ARM *ZtB :gQ?sk-7Ma*Tr31-&5NZ -t\ˣQE`D{;Ul`M0;Xh:Rw !nGرJrG*f^= Yf%ͧw*\r}K ו$I6 H.ԍOh"<~{PI죍x*Tc?5$9'hy۽*?pA#_;#ХH9g"}LghVjAA0A qc4jTm|++v9-h.rf5~I8Hꤙi[] |Oak {bD53U] }*]0x?F0&8RIhVnhcbmmDEU$V7tV-q"Yd b=Y%5i!E&t0 _NMC"$VKl-N 8!*@e@Þ.2$)KAc@Z+V~5㻈EM,1Gt)98 d)5`T5n Ӽ}7,eTLi;4gQ0qspF I@V ۑ1O[,kw6U qѿ%RM}s'M9f2 +EpD҅`xpY{>QaV^^ *L2C*[c` ?Riq"Def{clc}$&uJ3 L~%)i# Pn\qlCI;Vi$hAʺ72\#Sіnh`!(3/JHt,s]iڥ;(U6 w~nȟi6 ݩǵ5u4o4l-XLJ{vMXAˮn @@0탎Xe1Q'A$ֵi&Si)?ŎsGn'HP65#%5?M \@8U{h:C-ĵ<sOP.ď$dI9I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I.TnF1s<Oz twYsk{/l] ۽&^WV^KE r5D#Ms}K_Cˏ prs7uОGoZCONI?ȗ^ɴ|REhm*QO=GHHLMRӷ )B'{$%DqӯTbSҞ?ژ%(4xƚtOaN9rI!#?*\χt ` 9>iA#A=m9>OQvJ >~ )A-( ׾UDf5L\H<ϟu?Lh=)+co5D? \Gm{žFKJ}䶑QRGx$&=ςr@NF-3ꋚ"]1ܥ;X6y$3$e833O}8qgXg= #*B4D{~U R~?$8$([aq'~}}mg*3~Tk$1Lkʕ3`h~8( @G?S6/W?z?ꒃ)H?ON$ sQ~D'./> yC6IM3Nt8Y=S y"tד3P"EMGb=H D` 4x+O&g~M~?TOTH=Hoq%4yܦ y pCƅ߽?KG ~`~ZA4xYHN!d?թB~I.0gTCi=Jp:x)?M (N#a:G6H? j?  ?IMl<%綄-$mq)}l1`ѣO''uq?MO#?5Ф-p31sKa= ܤG|~r)j xT@8߀?ń|?*EDz[|MRR7caԆ;#" '·`Iyvk(`?BWKTcn8Pkȑ߹jxO޼ĒgLawt:I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$H$$K5Rck{U>t$+Dz tBCw* ~zPYv֗x$HUc-n Y,#6pHr >3LINtxܧ4n:vW`v'9!5$ mq% )'B]J:=hr=K&?JcL1au[#G 5-{R}FI ~=XԒdTkaP H=ҶD$V%TRI$T@Mխߢ_b[ cSPtL\ mk #TܧY-`Ks1l&JH~^$WgȷR-<4?nnAGS9I ~z_ItIBPNo?y"]6]ow5I\?_$dJh57Q' M%<~*p6_ 'Q$5sۙ#xD]aDqo:X}=-j=17~Cv ZO܍?@sҒI$ip`X۵ IPIXऻUş/$#ߏt 42Pll?ý'pl}fjG1D4\]$^DZf|*>  Gi0|?۶ |HI2$Be'͜ˤ0qAby'RH:aYI$!cU $COn;saeRL\*I2IlhH/l!(MOAs0} K% 3>Iq-- .>%"_%tOQhDڎROf$#n:(]Yp5)Oi(\0tI9t'e$$qNJY]Owl Bcku"yj%4RtUG_t2U>Kt'Gfԩ+K>@0fOVY|Y$lNoa`@ K` A.^C Pd=9 )2tɱzQIJt [ uK`kÄJ+8w/铦L̊ CGS{J)i#]-_L8]2tm{inV {&R ֽF^+!㗧 >E$!=|?O"ka8'd,g黖dqY(N-a0yEM,U+s-cGt6T7h黎-ՑŗdН%fۜ+[e$鯚enwdi ]8͓bBm#I$sPn>AJ㬔;0J w>)RI)pLrL1'LTC%{%.-9&ąN#"T$H9I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$In}S,~JZ VmNeHydLO*Mcߨi%+sFsSI# aL8?&{;I?KQfcQw JJLtM ~*L` %YV,[a~6pt1#VOڒS !jt=ߗy)cn!IKu8Ao_,?/ٌz@'l SyH\ݿ\W@s?7}on0;;?:Hy?w'JS)?#4R\2MMx$?8:ss[V=H:᧻Adia#q+7%hK8z%a/UOdk?^,P#m,._=O>I*%L8\_\I;Alj$IBs$;c-7naM< XSчxp?GLA7iz_;M%$8F:>%<~Uc et+S r y\?^p5`#OVjق16Dw?`ܨ[O揄wItK5  p" 0t1 |xfʃmo,>I*]'Hsul[53P|50<%1tu<~>?mΧ$l1-3׹K$D{Gܧ"O')4yOR1$`5OSI~9HIܩAԄ{vR=>)x$XDiE@8NYh<6O crO':$q(t/|Nӯx%R9'u9~{A&9&Ivjw))l+vD㖝y)*u%HNvNܚN?@&>|x'!L1'M w(R('>O}<y]I #`8{ =4PrLVR&GP}NakArr4qɩ}G+Xx6ik⎩$I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$I$$I$H$$Kj9V.AAiv19nRa! p&$(m̸="z[=?'9p!:-6<V|_7$N7A;5$1yr 0ѮSKȭI([gL@x=1o,)~8$!#yP2tcKPr+ g=ߑi~ԏU(ύINV[#O(6\$$f7 ZZpv܏)#|T:Hx-ݩqAsѣT_'ml5HI\Gێ9y)$IŵSAL6ѯv("gvz;'sOOzJ?*I$dzi\K!k)e^9c|D$2:V),$Y)۬ 5=āDM$@: 'V|4uI$%4jA q!-W@vIwvJI$VA'Q-C۠ЁA4|MZj&2RIR[|5_ItII`!@ޓGST6i" ̷H3?[LAdu |ʨqQOk ;~&EW/˓vjI2HuT/>Dr}HyhD[tpPns%pW保N%G ?4?@UZtpSqyϹMeH|DK0q $Kې:#BycAlpH{dYfc܎q9RI&P5x%T<(cڎ=ݿJ69;a XI2t`JyV[54Jmc*n51:+{JK!CܿVH)Sl(n' 0}V|"meˇnڤ!t͋$D}6͛m#mƥ% c\I$v#8Bn7چ_~hQcf!1V 7@@ If6}8! ]',.isJF){.fE$php|2RI$  Q&(G6%3쓱mII#)$LЏe˄4p*f7`A"i5I$Te \Z׍;\LK=R2KD(3/RbE΀O]M>7J H:pď?SD'LI $I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$$:Kguut%]T7L/BuP~d44H#/7qyَXLB{7Pձ+ō uKaNvnc\ǺZYe^ϸ롯?;Z{^#dYl0 woVƩ=7BeG>ޠơyǨNFV)u{_] })[OmDV tŢ 'o\u_\'pk;Q7Ō.#G*ySֈ3za~ `vGڬv@=C'tT@;pftd{r4Ioqe̶iTyc\I6@ۯt+ !][ L\"ȕԎ?D>'d m|&{m>RXXz= Ht?MymNo$1litAۯAsB-:<1r!V \H2&=3;]͒A yXڢu0 1S}nvT1Է4۸@}+:9%V}53|s1@Uc6XRSǻ $Fװj.]?m:ac cV.=/V i!>:䨩]eӼ:?_X4wiGX1}ů`!߹HI? ɰ;_!Qu:N*]'cce#̉aI(Lit<5B ve`; m*p.G.~}'- dY#$ݬ õWպw`خ;hucZ9בܔ_Y8N(8sZNu1ʺH~cmcHRc 1 g /ш@q亠[O ;?Naif-N+<_-k0KVMɂ^ָrL U^N0!w})UZ PF+ˬʺ/{$ܛY;^&L<x(}68r# c i? z#jk40u}5M$ZvR`FI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$RhIAI$>,@] Y՜!t vuV2dIߌS/ZG*s *WiQ!Յֿ to wYC~Έ΁\}kt3 eH1\u˓T逄t[˫{h!^afy?q>=FcDr?URdNɦh-`vHm >?Uw}7$`xO9:I&DGG;i`FOܪΛc$x}wǖ^UI$ soi?=vd[pʛ-;@x(UZ_nR$yI\Dhՠ&MmVT}FFJH>IEth XM]$Cfμ j6\ѿĎoh(rZuIJQ궻[-A1~QAGs[m}{RMQß'LVuӘ':eeur@I<#7]$Q{S5Uf 5DX6ڏ[o@x $qF~ _,}dIIֱσ* 'X%Ò2I;%U$iIBrbTL;-3G1屸A&,8KHbApRP\)$!z{!6C?rmG37$a5$$J)nֻѮI'Y<[(+݈>/$ TQr Z&9P?.=O+/70@"CI\l9Df&`jO-H2-v,q*?Oz!BtTVSAVm-J,ٿ(3?2t %X #Bx OVDO(t?>QDLtI>-̭NAԻ"=h?+1ӠqR%!Q# _DI$,>:v*u0aޣB&EKts)&2,>X]I$JfD~(`l>vhq߼}xLqG0cٮdwÞ!4X`AG,eiOׇ rKrc&D|$H )qe&A槓~=u= WI|Sc)$GN[C>8]b6Vz`Nʧw x5?Iml!m!ֈ}Zh?]8KrRI$S,>1h=,#̸M}R4'xI>ߒI$[\l̩mm5Lm_f-9siT:H$CA;=2G`!Chۧt+Cl9EqrIU̸&4ײNҕŵ82:7-%WEI&N՚_:[P@ӟSKCU)$LI $I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$H$RI$%$IJI$I$RI$EfU| AI%) 1HP:PP=Gq'ǕRQ%ō$F:I$I$ )$$He[I we GĠ$mh?¶ "$:fNlȶp$ @ "J}k6>>2_]aXL׺I$k?ɭI48A`e%WLB߮A@.=Ԭ"Jx|wt,c]! 1!i͠A!+$+-5 ۬@Q蘷~n#ۢImf{xj[KK6j&\0w&JTxh=Ÿߗi"cO̬sQGs(TʹJt;+Gd>g/{5>f{$^Ѩe"Ƹm mDIXnug9y.q$IPI$"4Vo-0 I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$H$$KvOu2]4Lr edpub.{Nя(G)T!)=35v=dm‘͔B[[=^_-E`8IINp kE5$\6>l{ENh +܆3ҒtVsrlwÇNN?g@;]M%QX7]$$ TiyjF )~Ѽ4 \'G0tI"ƏqzM-G&tAƬ"O \^}&49ޒ:4y5$J -kʯCNC;߹S?RI$~h@zP{@ԭ;`CG?gTv?E patR $k=KX_2#~e+"yA l1h=L>4n0(5q"r|$JTXg? R5>:Xfiw/]IOa k% wCBYSōAFe̍ Ihc6/NJD'MyvU.T,GWrR]d~..8)$ҝE&xVL**l3(laN~IQz|2t5Xiv Զ,॑Ph}ÎB9/]R@f,79A.956?NBIF4:Y'za_'LLP4Xz P ͗5'HJǫmLKq)M5N5A $PGJ3+?.I'isWOd{;5miwL@'5$J'{d;XT&\9HŤMn2d;$*'QsM+> a7 |{Xy:G *3GՂ~UI$-ךtǤV'oP꿃۟7GvI\W)$QZvPI񂧎G`;➆[3?HEG=EN?PVIFw[I$I$$I$I)I$I$JRI$I$I$I$$I$H$$KdLY$pY MoӨ!iNt{""Yq@?L\%3*IJvN-x<\*iۧS[˃ZAk:uF2#%07r8IR%a<m-k kɆfI06'rzicI۹+DyxpI6ph&q G5oCFܭ;eVnCg@Oe'V27kIRLoLyO1U.=͍L=&Յ[I:{`'_b1+[DV)h.wJ U~;BVbbHe~$7S9BŨ8mk\ Ɗ9,.L 64 $ZM,5дpPYr THRk.omPXAxZǡ8ktn@[;qKDG{$A=JJptBƩ)>JxaYpk gN~ZD%|s|d9MD>['wN _ꮝ42~c8pQCtTma/k;2m͢_8D8I2HD;*Hbv4tk~ ׶^= ㅍr?⮒iIӺ H#Y]<BӊKOK3?I'OVOD;Yj?eݏ II|k8ܽPRI$uON>XgA3+96@h I2tyYiSp@ ьIud'~8~~KE&K$?U/OWI1I&B͚Id.'SȤ^֍y ֓&?#OՍt'A~\Hz絾$#X56JYou$Qd}rI*8:Rz˪hgO5SK $II$*I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$I$$I$H$$K}6WGY[4dž󡖕 v .ç<1Y=R/.a qAVVksƠ'󿮢9hA_1w?Hn+n{kLח8 5Fcpu:V-n{]4?-uaDw6ORpp;9 i^Z<ƾJVm5yd8Kuw#kq#AkMk]S@#" !;O\ [ȅ-vO92IisOSŏ`GKG.Cs?y%bN [YOc]:5Ә'9vHa1sYvg"I;n!zO w {?;jUX%΄Fy*,պ}#Ը Jg !"A:$]3{iy |C,·s hRr/IK_ Đ>'O01$wN!&-R;YɈ'+bvK湤9h䄼1{qA Z ` `q@ ?"[n$Nh.$n3=P{_\{;}8{YK5~f)A͑xI K_ [C n{JK]?Lw}'Z\cAG'7{ 8,l3ǟ/52}cw٣|$H-'D詂9k U-;cIf[u3c\8p c$\{;})0ӂ"b~ ]L{ei4MֆI N3S~4-I9H?eHw}4nmxõ=Jv6%Nk\[SmjI'q 8cu{Rm{9q>D9KcALӁ5}=@L?F׹FsCv2Ox"`<GOQӓ $׺f '_b#79ulAOhqq8*1\V.lhc~D\i'B4mD[?3Ӻ@x"7X{)7q:ǂ`)6@yQZ|;w]O{nl@5@@6!JbV@_籀.K]."G"#6 >Tw5qk$KI0F?MMՖIRRh<π'm{ .HCfdkXfcC 'm 25ݱ;e0di2s8yLF IHw#  YZK\mRv8hoBe`NAnrjY cvL[x& GMt)"wN^}Ķ R^tgOSmd%5<6Z@6jx7JԹ_4ouI8j6Tp<\2׼rkZ%q3܍G<1Z[<<".[5?G4Vw D@ @3i n\ck{w?56yH?lqihQm sZ=Fԓq/q1ƤԵ*68lODn'lxk;-k4%ڏ716 LJJS 'NSkxO%C=&u?Kkn"'"o'-HR$"Gn~Ri2Ss( /`fw9'TCAiհ@㾩17@tJ)aCݩ׈S#ƊiPdUt1_a[5EI'q +Z@3)_.; !Uh;{?91$VK`px`Wc?=!5^^S΅6FƂ{|P=;Ƃ=ۊm;Ë|\Gz_H ?CHQ$ܔ8k R >IO"6/n-+i5s7`!YPU"A num{dZ_q`#WNƸ h;!H8Xp'Z#2I$I$$I$I)I$I$JRI$I$I$I$$I$I%)$[}Z=țk^?y6:4mX I(NN0w|Ϫځ"sЭ {NL;Q$1 <'󿴞ݯ4믋sjV޺Zsl x q n]}Q6T YߞR g'-{Kfaff`Tt<;d#A cX ]W?4YÇ;]R:{CPƲDR)]J zl֞?[ւxܓ4V)8.4w%XY7d;'&dA妉Sm}6wlo4S43yR;M\Gcj c!$-čiE7ȰD !u4k擛#p``b#:6Db5H{Tͅ`<}P}#I'ڊx>?$jg *n$>4_Rwl;kZ`>ʔk$O%XS[*""tO k⛶V~LkKI$JVA3O)vA:4honr cy)H)||TC<>L,Մ{wbsIs"cOT$Ԏk@<N֚.r6w9?Jf?[$pkF4 IH/R|[fTH-iGsw Nxshj?=$=Z"gSoSZKL XŒr@Ԟ2[YQ'C;mb_$ĝ=?p; tg Sn GŻGI,kyv OqpxhApDdCZCwhJ,4qD{LkS~cAGܘ<^4RLO2-ly @tDap/#gG䱍Bxmm h˧?k$LRa-"e54.{N Rzn1Ω{w9nۿu'o\}|P8C &}B0 ό ~}i8Dx B.ĔgIgoܐwQAlAsLeܞ>5g(M;ǗH At G'4 }&}O<':&#O쏧 ։h#SQ 4i)Ib{›kc`< OkGii#9UԞ?K`Ο,^`p>tCLKcJwрd3Hn-:˵ԭ'>HjL $ mRSI[G#;(A6'aƦ$OM3ZcGzY'I5r\HD -?E}n;{?g).Y ՈE$JccᇼG!H[ZH3Kt]TAhCcKOzsKmq ~H;;%&:~rFZ70{I%nxF;Rv#FE4s"g-W ín: h$~zpJj> X=Ptkw8IY;?dI&I$i)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$z}2i:ƫzy-GH] mKɓb4 !UuyM "ttv8byԄZ?N3 I3֝N-w 93ѵ#ZR]o)$rqO?k];$t4p!u1% ='|_RhI$!n>s:.jÐf|Z eB;)%cߣ?($*֘ Npxq3*[ΝIZ Oq 99Y$(H4hT ?$ʛ5<xa O}ZH/?~9,'Li.' ow ADv朗݇RPIW'~Q>d5sI C Q"xO2$N ?[cTOarqKߌյE#SOI%Sn/%zM>Tt( ?t,hlT`5AG?j@;ݪ.c.njJęїo,$0wo Ïh ={0N.LZIשBI$tuܖ6' \Ēy>!"?Qݬ@Jt]ak?PݗkMPuf?Ԥ0 3(~q?kh" DfChx )EI y?Cu~aEɛY\ IP#s82hNzs&ؓ4 F6:`rC׉]eϧ?:#D(H e[`Khp#i gRB2}'jP&'eRYR5J2H?S[[Mᦞ_MSHoA٭?{=S9Ǒl"BezZ iؓKEqܝ @CI?zqxCJ3V7b|JvgRI_{ngYŮi :D[)q#BZLݹ4xmV RwkwԟrHx B='2c'Q]1I'g2H,G'k75}/F@Lq68X憇@A\qgOa0DcKNaZ=M>VjGw9B$I$ U$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$H$$KOL. iA+Dɫc#4][L"D"hv4~QMtR~@*em>ݠm }?t6]dwN2W<I%ĺӏP;pc]I%n8N旴8H#Umuho$U _pN5enOPH/I<$IH Xb4O ?oq!$D~INE-u>i @?yq mtLvuY%YXI $i{)3,<}Tkd8ϗ)=yǔO+EqC*$ 78{_{Z:Ci{_fio}5I 6ojJ]\j{?]-}~7N.S\^{r?؛5c?|TI&-hs :kaLwX'OF=G$D~$\Ss-qf FK`>KAp| u醁gEDHr?V(Y!x76LOkfy1GiLjSӋo|T@))Hkof׷I#6VpAUN$Ka~2?87v|?;n9tpYLlOйG7IKih xI1:tFKqHTOY#?WXzjI$vsP;vAtDƮ4xsݤFg^I$\IJIBNƵ T 8;Oq${vme%tbI.T`4<T7{DDs Q#wr)}YwE^Y?IKpè<,"1߄7"q=Q4[ dObI;֖O\88ZTI)VKɬ=#n(o{in_)Uco#J=$z*)R,;þD5n {O)lyjcV*_/?sRZ)&.{d;k+m8;)XÆDtYQEqi3N/RIJJ6]'R; UIppX{!F{9$P|ORtL^WnOpy-$Nhi7n'P "O$LVDeAy: m& -ZӠ?8jw'*JI1"Ax?Pa<K$ u ##{"á__ғN:6t+6Uީ%I0ԸNѥ$II$I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$I$$I$A%)$Z;-tC,~.hLj-%-Aӿ潎FzDf*LBJvDvT1mlH2yEϴ<m#@B{>FcQVqӵX8NѮߤ5iV=!cA &9ἘB{H:k/{A*خ :5Vv:*5.cVuT@)q(M 0T@{LO#M.l59EWm-{\cR"!ՀTf3%7Ƹau$Lm˒O 3q(f[>vR,\§cyGbF{bA:kGL78΃AxPa/HhiHХ+*-iκ-80j>?Uk@HZ]2<~ߥe`$7[II/Q.;5a9ԯP 'Z*RM:ƴ'IHX%P -`Dx3*w\^{"lvy5Zt\:I) T &h'i*c?miێb?hopie875Hq8*Y$=f5S 6 $YGҰI{)Qn w%i04ΞHzC@kyR0:sDDm.c ||1~-F@l32%4rcn؎'U7|XkL;bE6j}JjIRW}6A?K}SjuywJ'Gq‹$6 B͆4 m h ?i΁?DrV F.ypB4gq -5'鷞>JX#':nGs.\?_R~5lpgq =y%-ynߜ,/@wT7qahcCdJ]UHJ0;=fRu,b9M+ ӶgH(@t.#Y'O%N-L7\t-]7PƵ͖GvbVQ={rU^זAno>Oc  hw9[NZm@4mq\ | JHqc|ل򟠝4;C~p7|N9[|>ҴiTrD󸓤 Ӑ{m7G#qO{FEt": ;sw%TA&R܇t Z^xFnʖIi 7]57 ĉoZ#"ݨNL( Q;YCAKSSXys{oǰcY/Oh1q Z8qVF!@i'ݻʪ!&6}0+t K%x i&wffv֞toKo4}Pm2t&{R ;aUjq겷n ǴT$L\7O*BS҄ݿ5Bc]\DtmO»F@aƂ?+GH`I:Bv?J+Xn͠i#_#Lk37a> @?K$Hz7Z ~kOeiZ^$gVs$oF0GLe {*Ċ ?IVH ;KQӾ"u9+Q!鉨]%vα)0?[gȟmEk?K OcAky4Cu8 2I4 ‰7YcZY}\5v$ ˔stMOcqH8?JRIDz=CxN#PL\wYoqݨr(1]z?UI$c0}OpϊZS D)$II$I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$.Nau64Os#"5]+[MbK]'w}V* L8'Q1Kqk_QHm{av_'V2 ?CSHk`[Da{~ &RwF\{97Tp'|x vPEl a] DAQ55tgefȟT8̑(hQ:q#@"F*6>Qk < sîD՛Ѱ6,C1 d6C O=N!=9ptYXDO~S{ H ȃ԰h%Nt+*FPiN6ָ& m{& vRcstMKgq3huJavis?~4Q="KLILD|S7 u--hj57K`Lۊ4?',$D6?ֱ9I0z60us;hT"y=8"NƁ q{2Zt58 :iE-E 0L t k^K vI)xݩ A#kN$IVi?Ť? 0?iiD fIbA :9'N N-ԗ8C?iZl8Dq}f.{Y9dSSK:1F+OΞ)0s91?Xm/2֦'P Lc/,m$8ɒD4fx(#O4dI_>y$q5}$+v'Spg_~{ѤÑ8άRDg-;Xv՜4 qdAʗ@lIZ*E1 #I(FK4MZ'l8 Vc!lgڢH t5Ā&:aop%7򨖼DmEfAISZ/u΀e$L1lGNC 7mb$nF/!JB6|HdsN91u1hI%Gsv#M~}C0HyN:K#R}'A!#$";y2kì?DI5FԿM/_$Fh+cYv1? l/q`tMT 0\y [K5pX|\5b[{D)㧙NwH` |ݮƺLs8Tm` [zU=ƷxbIdQ]Gq:H# "DAiuBk5~tzi6X;u_A*&^^ 31liwMhhF熡q:Njs?Un&IkcO4Ơ9si?J N.`Dln@z[+oz~vBp>#,I$$ $I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I%)$Z[kx+V3cW3ɱ晉>!t¿K :"ÜAQ\`!n;nԜ?w-58H3Ȱ~R㫴loSK[ -:n&"[kI1nql;q[Gn:)n$9|Me'"IH۬JҸN csI H*.kH[;$U`pxi[X8?(4tRhxRk\ "pLe<ī+K eL- ?(ghpmsgy:%8A0;0{$o7YdTeAO6r/p gKNYx!< >|piu:ǂv:ƞF=7zo!2GfLo!g}-egƠA'OҚCF:IOΠ5YSmK{PXsuU68o{+-Ȱ LHITFgNN$kNTk6K.OkԫkCI@I_I&Ks)\8$Z-l8T ṤF:)H;HN*T9f`FSXvq#Y%O ~V.ֿ C_M"hu BXmqQ$p7v M{_$]Cxa 9x?b-4Vև+X'YZ!ۀ'&Hii1: ijGRcߡDU]u!5OsZ[ݐ?F2[kGt N$TcOHAHk^.'F07n$viۡnRh̩I#lBE'lNwcGp>){vm;.z-y0:H_kI;m0kxNHwp)[ ɒYgwxԚ#A"쭌րOU˛YsDꦮ=^ga"?O9vd@k?|P|XKvm'NP\";X6bI?JlU(d{}RA_=%/gJw< &4;=fόꚸkA! TMPa/5$&` |[ߺfcXI,Ԏ7G`c7="w@p.. IJu=5H\4ON%N[v9CwD_]a W?I ۠n 풂&Ac`6Ɵ#pw 5DpÍgB1ͧ`RuM4Kɀp?9= S ۣh0y97Bt̓n%v{t0N3 8dW Op?;jAy2S[*qOIWԏYD|Bo|Ƒapc(dL8&DNM@13O.wq-3>Dwr*HJn 0D&7l1a IIL*-/ɷLtI$AI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$贵6 unG:\Eeh4ucAQ}"9Q/ ] 5>#=ӺFbֿ<BvPA#l#$cڏS\jf ߽"kU]/k]h;t#4εl[ϊu<,{}OMfyn~kќ6465lrsLq:(C\Ob`w"`wqCipDwDsE5y&{ͬ R3[<@3y(8?G: 4;aah;%$?kJI kk'(P5DZ.j.eI&Iq5y1#,,@Z?kj˹-k~jRKӨ™lLu~Z#@V8ˎ'ąCkk;F"C$Gb;DKD?b6O-h"O}@mlLG:5P\saś;nw(Q%bW9{Mk5a$}JJQ.@j\'p) y'Qq75NRp>#mHXtk)sK b?ĔcIIvkZ >JmX}{)N]`,t44J.%"7hoR/ПhNk<SXøI.@F.!i-^x\H79J:?Ry}~Ǔ1R^`p<$)XnaU] kdO򜙤ww p47hvHz]dh\j#(ˋGQ}4tq]?=ۿإH4͂#cUP|H@u%!j]t xLL_Qݧ'{ɀ;K}9?iK \ : Dz7͆4q:v mI;DGQ Tɳ:C]DC~n$$QW!M v7s|ޝX+p{`9#S[lpiНxo%ARIlxykƗ dL&i s>}R@}Sce۽X'ЅB@:G'!s{tf@㲃"4HL}eE$[}C ~&{?HtBL}!-J vTt$g Bv1`p'wM]o"Ǐky?i|(ִ8JQn{4Hɍ  #GUaĖB |;EΝ Ĕw .#OSwLB>TwLKw?A9m'7oG\O _sOzAK:̄ 5B.C7n7[kΧ+{ qw#EQ.Gf0NI$AI$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$Z]{wҏ'o@]]o!#B?4$[DvPI5 nT[_y?i>ƶ?~k,iOq Z9 #Om;k%5vw 'ִ` hl's\ѽs] )b,y [-k@{+V*k w iK[~\? wsC;Z;5@R< 5js[OgJc8sq!ga HLKZݡH-$?y4Ye3i #G1k9iqa%%`X\ZKAiq{fK~!JFD:pn$Ci }l5=h;\#p~CKNEd(o=>#:#}E%#2jƶA"_V`vc;PD kJOt_k6,i뜃}slqP]8m Rs` 5a yRca> lmIR۝{NGe&G֐KvtkݴUj>sa3#D40`'_bHW[YYXٷ1I'=.Y.lpl<)_IGM͵9u5O~Fo恴U|8~yrsk mhAI ƀv k 'ỒLߑ- =E5 ֈ2΁Jcmkv"0 $i >J^u<&s uAIĵ:5dgw靈"Nӵ9E0w˴ڦ`ij*S8;k۬Sj Lʍi }#2@;kw3ӬQ9X݄Vi5V{vCm4;{08R9]vXl%g;a`}CLM  ՃYxKm`.t`m>*mmkNBI1lDzA I):knʡ#җ*h nHy 7zg[w^;D$6Α<ˌiŤO6ie=u@XѠnvQu:U5{ZTg͎L7Y68hQ42H8}K>(- f%FOkbe4KLs?C=3-3`< IR0#AAs\&;@6DIP9F8v H?&o' d'AjÚ {!5.nHL=}:y&ۛLHx;? UQmln<+R&GsctuQs yI9ŀ |AL\iИHkuwLi,gNsǴ7v< M{ls]?PA"{kT!&4SGb)U;`9"JSM|&Ox;K]Htܛg?7cS9Ė3Kc 1x;%4JVӏ~mF$2]`kcӷfKpDn x" >ZO`P4R\Ct'QXڜ=Fi{Z#ޒKѶ&ti:GaQEMnI#bG6KgFnѩF.9;eN1ڇ"6tN\4@n^LBeƐ$Ov)Tlդn s?m"S5Y$t(s Sm3cdz cIC=VN0=^l {&!'Kp;Oax7Xln̆փ<<ӂC;A^ c] a'kGɭ2I"7DiQR5;y$L]K=R'YDWC`\Io>4ILZ\NI()p[f;v4Zu)nVƠURq:oP>A HGhܧÿR1Rs %4=>ѩXYf;=k[buZt/j;fwh 5q= I:hYÎ .xX}.f2t$ $I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$xs@1خm;| Z:o#cx Ggs1i'QJ \#f> 0Qeni#$ܰ-Dw7L~w7m0\&#>doKX4Odcť s!O l",ŢxI>QشTHƵ;P?ꐞX v#b+K:Du;*e, V87}%;[ [?k;st:SvM ftΤG5vǸD"徕t?1;^9}՟rj] mZ-GXjTL>6@#3on!w3w= !r)q`X%13E0[Ghx_Q*E IǯulH w&;BLYNtY$XlqiR4P{C0{H!5H4SE,c (I($?H(GREykA50wnI65O Vh70IY9u  븉(ߋXsCyos$yZX%%2LR35MvT-wgݤVz~.Ec}<Ӭ:;tOvu2Rg{z=E?y2 pB--,IC7:0 RDikHt:;*C33h$@%6}2OqtOs4&}z>(`ֻ ڧDe%msZH KfQS'08m2 hqܟl" yM $#ݤj؀gݡ ?f{ #ۉfm B節f! qi|9>U{ 6v8) vDj1$hd^:bSp$5*RJm549xޘ q7Zuflt˝Ü|L@(c堘h:%$)XJrt#$BդKX<~5αZX:i@h;IYC-`m#L\h/aZ  gS*,c$R1,Ĺ ~h RmNj wmARd=ݧ~wc:jtާ͈TÁxNXּF MU&%A D7k@hND wҝ7sH`"u*HS>H{`U6'=QQg^x"tڶ'kůȏR5 A#sZ MH-ӡ#ڕ]nhѺ`0ߏeW-ksO"I@?hc ~kиi">VR] ArNh =-46}0| k`q67H[}38=}=I̩4ӗC͹:i$iJ4hcùQi0|[iI* lOv]t:^A!ݮ~bg78~S7F:Jm[&8H8'9 oku'AL.i}5;6'siLyZ`4Oǚ >k\;rISHhD)eDl`%;H~(v}t?lNgY;n$PD5swo.%i>OCel6F\;+`Dh 6x|`nlikw1Iheog,[|y@k$HHQscY -~%۷D:nv=l]'o).cZZ%q-kt,<Ӻ~8N$(4]%@ =;M ,279Q}9O4ƛGZ aOwrBhv66x+>ݕW6&6: N酪h}z Bys햆N;m!%(xtN9@vԡ/$ 1R?|O;K;!GCE Ɉ kvLj'trOVV {) A>6sOTh-] )bds q|MfALgmkvLѠp-4 3|.@ȹ$t7Rۋ]T!EMO t0O+juK\eVYD?!,ƗNII$JI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$q`N-$>3\[L] ߎ]Ih'[>"äGXMlЂ ~o(n#_wR{Aݯj^4 l']<H'D :6zNߤI#c7j$i5%;h X=Ã#֚Թh #}ɜSL1D"c cviu;WQ.p  Mb7OJ7bmq.RpOM|<\Dy;c{k ג6:LjU[}IdV! @y渴hj>[\`D!A?;褥Cڇ)|q; tk:66$lOKSm$ˤ҄X4 L! OogB=,$i=ʑI9IZODCLG~g9۸QkSh$KԪs{I'Rqkt5gSl@%09KDח{8NctRuﲰ-cF*ձᡜ'o~oX&j $-[#>%Dni.$m_Sh>~`sIH@8ќIGAǏbN~fw ﯚv4'W4̎3ZDti$7c&m":@uw\@{9 OUɍ\yX[~7wmp3\5?c\Yi%kA7V.y;ޅ* y(m#_RkZ2y$̃hh#o`nCV4&wGҙk/#O{Ԓd#ATR}Hw q)n'0?C%oc_?bv9t'P{ w!恧2gTxzq'_dooc785@=ɫ;LD/%<9_4UK h1ksFO dnPܢ9 vZݍ.-?6ph@RBvց#vgtAT:D~4t:LH=L$p`L*N M'ysL@ [aqqAEK7NCEߙS.#@[QޔM5H yDe`٠fT'OtÂDJEC $U!54q#_#K+p%)x,$=#Q(-S|Ԏo=~+,N;+,^sxI$I$j)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$u/6Dź}h 6)J9A~\@TH\?L:[?Bݰb6qYxy#^91Uivry?NזTV0@Ldp+p}n9?4 D#~5Xf450Ƀ'j Z`)`Ds?6Q!* dd$+(# pR_hZu'pt0!1D=4AĶ=SIZ9!p׳edt{5S>}ܦ:<9ܡO`~.RЖН$$uKX' g@~i4i<4sR"3 O'a" %':w`hķYL*I"6Ov@O('*B E/I iIqp#sBIѾ)H+AL줒qy3?bpw.괻O`uҥ0#>' Bʞè$$bɞu۬ls!yJ`\9a9ӏ"D!KhD$DI:}/Na/:{i i5?Ih~IVALF BIʓ#ޘpl}=ԕk&q i;A=ϗ5Ad:'O槬5Z) @=?Ԛgdk JӸ2Nin h'x2 kM=-&5 WSDiLH[1LC{7;R˿ѥi`a/I n42ObNڴe&k3):(!%wO$Jk:nVmti-EL@&;q ? ;[+XR`+j ,w΃Am;cvnp{hLFd~*DwID%õK` 2NTȉ<[= s?*YlH,&'dmkgw#DQ#vL-fENכ\{g6Os$ܮI&I$bRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$pzUMea#-?-$vd:K?5i(NO$%*JԐBpOǟ$4=6I2DGb˸Ftb:wH'L` v2kI$$i?Sg_0nBjI4J{of NQU$J\hĩ ty6'RMiN ;7Mt)T`Dvy%)$J$D)HarxԄI*I$TDp)Gr4Md Doauv Nk> O|J]$ԝ5wt㻒-2'${I4hܩm7/ URID1@xX$OOwNBjI2RYOŤ~D@a2{&H7=EI(GfO.Mf>s5ѾbDBV]2I!ǎJNiMg~ "@ ZmIJH`k>x {t@Jk|k0}5˯"t 4~!#:$$II$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$IIJI$Ss벖 XvUC^-x\||BP1!%$TK4'z0$IƜgTQC'Ití㑸=p:9?N@^Z.\~7 *Lꔼsgr$NZ.$ ŌRR0Km"2>C||W)IB?916"$P֘l&C>?*A'%_7yy4j(<|Sc.v tDoRac( I1 J*bЮ8j\7vO#C.Ig):ײܕqYM$4.wtcD@;!t$vc2>7 T{BrLo(7R÷5X=$tvXMɒӧL}gky(T#mS$ɾ`3gEk)Mgu|_aP|d?5'HpjA:>+gHoOݸas'M8k?xrn\&Dw3;%酱=D<ʏa4~+,}a=Ô>B4Ի2i^S l2{#w><P}OY8?Lω!;uK>?~!9: NJa$}ސ㷂Fu!hfy>Lusˠxjrx'^?@$;^Ѫ02|ރ@°KDKA:(~/tl%8=@TI#Y5`ΉzݸB^1ӰTv#kOkIORs >KU{W7[g=RA`G?Kp<W%/ڴS(/ȃaOAʆw ǰL~nȩy,G$n=O%~ p$IÇ%H1I*$| ;83lo_kT>H?{PG(&9X yI{M&|#TA dTuHPK $8d4"b;O! 2')}àuROR!~hK{@ϢLH$NcGT~%GiA>3xw)*&#Hsk O#II6I$t'ǹOmGoHן>*ԒE gs5XvRKQ._ĥWI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRd$I$$I$I)I$I$JRI$I$I$I$$I$I)II$I$I$$I$I)I$I$JY:I$I$:I$I$$I%)$I%%-$RI%-8ùI6TI#ZdI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$IIJI$"4)$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$IIO%)$QIKwO?))I$J:} :&KRM$p 䖘YP=߽%RD<!`"{,-ÂPOLvJ%`:n Ha^iARB&SPRI$I%)$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$Q*=:rJ.xo*p nc&[N%z i-Zd vnγY WC{-#Z\*sf#l*Ϋi~ 7p\maЈw܊ pĖJrwDb[9y:xjl6:'uહqcAEkˆ__h 5yB ~=>PwTH[ϊ6L'o}<ARBmUK Wɂ@Avj0L+E}~T tKtjFY /o,+5jLև>a+EKpTqo?zۍki䧙f#eq.ΝCs'Bz6J¸[*4AW4ٿ7Ήs~$QMųqkOu;o09 !IRI$II$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$vVkjRjI$px znWC@$T}7x%^ڤ)RTI*CKW4`Fd^7++)$TF#)pS\tTIsl!1㖕9ON*W $VQrk>wx6HpdzHbji{y E.I!BI!I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$t|r>ĭLnƉ|;$ Qs ,Zu >KGl!úڪT`PJ)4U('U66ԐJ:ꔀaA B{R\`wWD{%ig΁0 FC.v?+{*msA`Hkn*!47`jfveTXHh\XuI]4rd>(ccAvCq%6 0!L׿Q ;䙲RhG8ӬDCqCsvciվ\mdDILakB^ $|U-5üʀ{ݷwmf]H{F#z#Tst@(>"!'{ptQkF!vĞDOhSU{PƖ 78;T k Hv#SD䊑pyٸx. =Q{5PcPx vM̺ \4p5ALq9R@! f0 ed+-{'04)53o3ò9 Vc8!9q:3Urm7*F0hxS RmյȍTk~3okСխ zp[ȫSGuC.Vihn' =X?>á1;XRsZ U !U;O϶V`Wz_9}ޣ-E29N<;`5\K;'YT{ (oKKC0ctX+oKD뤣}! k0O >ZGֶfp} ;TFI\%J5g˅R]_CkU;%#sԥj餫Ր&fxRkZJNK[oK0 *$,iTI$I$I$I$I$$I$)8%)$((y1u(I)tHI$I%.II$R$I% $$:I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I<$$I"AD5r4$J,3$<'.RI$ 9 )I$b'␘0KkO3䒔d`Ljh: ΝI*I$d|Ɗ@pt))I$T>!8ag)H$Ii&s˹v蒔t{BaS]Px%)2R@ 04 EsmPRLֻ) Du8=E.I*x(N{VhIIշ*GRIe9o!Ej9 ٌמ`e:I]8m7j)TI*"YC9P-! BL2I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$+XdmatJyi$ٕݑV/D Zͨ ! KÞA~O瓬Ni b"{$(Z7rFt% :Rj '\I)m2xTr:`ɏ%@n҇]ЏHGJ`\*8VX4O`;I  c/TG0uj55~q:#CO*pRpioc⒚jpbٰPǧ墓K^ &|%>&2&>H_hS-p(krG~#prI?*6,!8 XcJfZ?ޤ O #)I i%Y&/dI1#RR5< s杵Z;"1FB42~J@5o~!uMpe"yv*|w&:}:>T6G Fx$v tkLv̑+gpkxQu0%ڃchPJL Gk܂ hG)zs&<8N@ ؕx0c^Nۜ~26 k͒&TJ`~*.88pWDﵕDSx#lmiZӡ0~iDY" I w`xSn @'=X;iTH2|NF>I5^#Ku)v=Rk&i{$"4[MFHPR(N{ Z[x =I󢹍[A+aٔhS `T_{sL&JόDh˯ F׽%ica5W9̣æn_&NY$Nljf0%ŽEk(k~Z=RnZ gB_QPW T]Y's<k-b@IXeHXwi|vB} \nݰoYf0->;;H(o 2褃o: dWN9U2ox,w&%@c(ucsO[nORch>>JO xsWX5ПFq u\H?6<9HNO|e'cD|T_[Ioo8C;—ր`TLi魧qII:sk#JWX!3[(X>|>Ϥ=ՙnD;tm,fgIĀ n$1j5t2hQ0YU#kDJy u͠捈{ Y6kS]ߵ:Ԧ y&yppks5i;o?54=|,BGm.*A{-Hhm0㵿; ~){_JZ{^% ni/? [lUdckdǂ[ B/y0t 6' KCAJNJՆ^BcdB:h6x2=mGSya 3J_pC|̶J]^+ϵUo0%x"9S NLX glweNXQvø(7<ݠ*;*oِ^1g5ۨp{ets[$+Պ>~mj#edNs><+5[LuEVVj8;juV=Cq [Km "VuWۥdHsYAo S a>£Ө(;([hqgXKY5yvefcxc |=ȼo1߂f;6I!gCd~+s[ӏq%[w `e:s^:11;WCC삲@4PW)w8Vʥm Cu@V'NDŽ,sӲl;IlVPeܐO%e~a:HW1Eu |XT`ڛ&aiot78Trnp`hocIs7GGye g,% hZ?؅6f;;|kCU+sȰ'Ct+ƒIXw۩vݤ hy(hxAt0HxW#v ,m\BW_k佡Q갭\{#a/U)e}U=;Oyos֕ & $p-0y[Y10QeE$I I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$Iӵ#Տr4-I$u9fC8$ipI$ptRI 5I"@TR%02ډK3033+iI1Nݑ]-x:*"`BJg $9͒goT64[ cJda RiL;n1|)wntcp3)ЦM"8AqL| SGh'on) A=Ny&˵(w9=gxI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$p $$d-NvFlzqğI 5h7K" @=X044D8h&`*L"G(M4 pNHײn BfOd :G%<{@:R {❵1ڗ|{PRSnα?rF c{*M4F08S$$TU'jW\ȈIԫ'U5Ǔ!ŎhI3P`y:)an؏PSXc\hY|hzIM K[7aXE;Uzg̣0{J~0{P[AX7:cDRő5Uźh~8(-0qha"R[,ݸsYqd4_B\֝&WnS+fK_݇Pej׻ c8A1myII^45sh)WExx^trJ% n>I<(۫$cǔRN؁SV &8CZ .Jt ʃHu7);@ /}>otv?E#Vvd3YDR;`y:"|uApcfd @ $("I{ ~? c ʛX"vcLT}Ԙf4wxvZ)} &0{!ipv(u<0Cg[AdsI II2k6?U'k3@7YkvGC}oh,C&XBf~EtǪvx JXlqƏ#EVSd,+4.GsELiR %U41vX"X 8D kpEx6VGpՃ]GtIUSb]Ux8w>D<{\MiuDC]T=S *ugkZy%^uN.j8"!lՔl4OiY}XCÃUk72l!Nk JeB{]EiC(,~ߊkks"-w}{ !4DLlg"~ LL9'nCޅC$5|35a9Mn>E!EIJ%N⤏%HA}ZBMeQ S8Ήkz,i:Nǹ |EϐAk*F|!;l[l@9 BBfYY˝kMnil'Tv(%yX9&ۼF|ǂOE @kDj#%R cX*m8ֲ?*_RvqR[ >*GLs=TB4IN;D0*Nmcmjz{N+f{LQJ"kP|Cg:b&clZ7?#^*^UKWxFGk@,58>J=|ZB5=/t9K* +%̻Aۦ"cb@!YΚ'hni#[Y\84)c}7IkL ýd u'M=54IyRXi*ޥHJ/$ \SZX-$<&F\} IsVkh;Xe4뵛 JPqf7p.{$4ugӇ:{x)fddeb[5 V`0Qh V-lڰSmc2|<O}{x'7%>1/ΰn ޫI id + *jF9k|[E8MsJ;d48{>Hv5*4\FdKS{xU^DeT')Ni &sffrmsFmVD4V+ua&uӰ\}N|1Ǻ *J{CwOރ{`gUε?FS쭴N%HK"|]}'IX%J[:Tsb P$zghVki #JOcX8!cwz/3=ҡu;np1}oNΥooh?Ue@VV^ ש;qz;'BFx;ZV{LDjr!O:b[.5%hLL!/F2#ug+sdʨI$*I$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$vIJI$"CWjQ)$PeAIӗ)$LxNJRI$ S&\DI*M)&۪s '–hײc|RRhb}Cd-->J^SqyI{((o)9ϸ;T #D% <ԝadQqND=QqF 5 r\"dx;O I4LL`G)]4 #䒖#(O Bt:g h $5%%,B@N:Izznl$CMqCI JS)tP[zvo'·_4ej 75NZITrNg;B}G֎jN=XE , =Sfƻ3`e=0ַtQy$`M#gie~.h:v5uuq2s)t#h?bqYѲPvotޫIW`>E<<8rZN~=/o'Uk/6PM3e`2t.wP*un7D4_[]a*yK8pv>MYU?:Fy_w@Ţvng;=."B&%XPk+3%ΰdj 62 vYklh'u|I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I+x6Z xJI%<7U{.1[I[XӸvZtSa䅅48/{ua+,vh: wVD$x JvlP 8B㍥;@?d0e"uMR'H !$@I!3“Y:R8\ $%Eρ J nmA%6YTŌ[pN-#Zp`E!2v,$I˲b c @ܘ<O5!;C\$Dmb&L]ft=*m4k4*P`(nHNȪ.ip:$k}#ġ퐤)sBJ`vk|)ߑcwQs*>`hScr 0N^/qהap a0@1 +UFYhHDJMh aw߄HϦ#pS >@~G'Ҷ|%01lvR9HA-G&#>%ڶ;VFcq|RcS$9(WbC=(uf^j$پ J]e9$)0 nNk C,&|5Z( 9#u|wEICh.r@i?VkCmljMBoyy)8h''O"K"7:vǁ }|J@cIVCHI6+t<0BHaayxsDw'n('?KDW1d1BEiGux %/dgC'voHI0d"Ϗ[VwCwP xTW'ͦ{u*hGhq#M:uC%V>dn#T[_,,so\ { ZM66;xM\<&\dcZ )QdDYo򩶇 Z^k}{Zq $e]5"#-@V+f|ϲ12;jp^s[s%-8ӴZ#P[5~p>AP7zK[:elgѳk=|iR}5Vf@wefT("}d?ąηN:L\@V+6Z>z ejvE`ݪu>';oڡm4H음 )p%KN()y0gX)ӹ+cC8!ddmln^`ݓÜc&;e*ѧ );; nkFةWhlD nJ0 '3r Fd[ly7]hcP膎V9Ȃ; zE!/ XZD9xq: zdX]kfx"]ck1.XAMsV?JVc]9nXy_$84R!jָj>e8D9-fMݾ%hWPn>%Y%1=M.hwqj` :#m!GE"T"%LIΉi<{l!;;hu;O$\#h(4)őV&bP/loRk)%bѯ VN˚ =쟊kA_^Xaʭ6= )6Rm(*}lOCk#h0ʥ͆J(d P[$x*h3q&\K%#d;rq-kHRS2ƝbShKx:e[ԢAqZ+7keGM| I~)JD*ڞ] 1ly |uZXIw3N ,xdTݲ@$y9XBp7 澳twt0|I65Vdo%&NJj:۪pJ\ u@Ԣn<&SpΟGu5Mv!mg;Ʉ;Q%6CMù9 ڨ{AnJcZy:@D#*7}8ަo< ;KOdT"YB{# IИSgLm&\Ku+B۠ZmmKi𕑜Z]> x-׺|٣p 'KUB1B0R=Y' s%ݒsh6.Ulv'B ha&^5@hk4Gd%/X](`wTm.2UNsy:ʍxp@u6N1S?50|tR8Z%1LϮ5ҏe4FiJ-&c|B]s@JQ$`U>Jk#2^>hҙtaI"T:f.Fpt=WHT}8i= }gn2RucQCӧiy~v֨?sX+ @5upXm+ӝ[&~v -I)#)u{G5*V lD7Q*5Wp˼?uw)mGЫ,sD+ǏѴo R{vZxBm!p j@O?l;,ߦy'T]iݷ1W$hU `[;5qm,w_![ZkZeGjfhpa=AضwϬ\4IGk A<:s˳:AJO[ytHoW]cnOiۑEl/@kȈW#Zsy/\s[$WlC_Xkx>+؎۽͖Db:mkE7A>[HHOu>@Ιo ld4RH$'I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$HFT_VkII$xK@'EpI.I(I*I$pRI$a<'s yHK|>I%dI;H&S8㺋v%(^}G:"S JZ%8 $ tQ` [ۆ$BKkc]<ԃ[pwz$jLqi=9p)4@ Jڔba>Idˎ3KZ!%*R>ih 4Κ)\?#{Z ;NR銈N :S 3R0t<)Q)$f{:D)8Ih`$$)wp7`0%?H:N%D&Shu CgTjNFQ kyEĬzt7=v\:^f%N>C O(y/pFwR~MurvM]҅A[-։ULKnJ tfPXXHGeR +e9,N?t0N>t%SC60ި:hҬ-0ήc' i;vQ-{{?$ƲA/6{pM}=ɀߢyI 9nC nFi0rjZ;HEKn%rLQy9CL әuRDpd4R:ZKҷYl"gT{F0W1ls_K^j<¹ƫhE<tV1|@jZhOY*kMS{>LC\bAW;s!.{YqOһ^y#[øW{HQ0 ~U}ƒ{nY$ qsjݑXc-%R&5ֹ߭ṖFJ鵰!^gNQnha,%ŧp*5a^җa}NM]nx.mU4ӨSCK둯n\ULPPcד2;48==n.q ߼tXuɂth+4he_{RQEf[[H s7t;: U_nhsG͖m 6}\̭w+a? ɮ:?4CvVV9->Z!K8GgY-feaUVG]̣$\7ap$7Scyi%b$@Oެe ccJݶ׵ڴ!bgu˝U{U.}*ˀIu9=+]7ΰ-wIgQGn#2S&k ˤ1eN #UEx Cأ>H}Z}`R䖐pI"JmI&% ]#@<,$c?--uASI%t`48*W ]$ҝRIZST*I$Ҫ$Bio: I$$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$KI%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$]Z]̍]jIԒHv\x9Zۈ/[:qUiaW>Nꭙ>A DCF [Mƅ6ԝ([E1"NTJ@!8l !"ZRsLvMQ A6<R>O%D0Uwg0L@U|.x)-4L.KnLJ2IihQm$|zMi"x0|J(8A#lq%$\&is~RÚ)͇ͼ>~ޒ AԚ R5}/Ii:OM|'-p;~/:$VAiG4cNͣ#!%J?Ni@mI{ûh@?rn[{ąmsݠl-ﯚ;pwa΀&}WJJk1ፆ˺mI!| V;`ݯ!&ZLj'ѓ!5ci<TeLƜsRۇAAv:G]/GòNw!2V5Iܫb?MgC Uߥ hWf?UzkQ1fkZT.ȹz~LA8Q;%Xƈ CU,}ly"Wcvl+*I`;GX{ tZe r1s:]w'M~|2Ƽn Oc M@2C~|4G2=cIc čes5C_^X*2/dh$Rpo;IS;r ;T!p&t;.@hHnђOq8ul9+ J9H=/HKߥ$;Jj9)I:Ahw=@i) w˵F3s|yfC-ygPMX'3Pm$w .ǻi?UsYHw 1j6p; qOd좪3*ɗI+x0ޙ,cA*In恐/а#g]ש=^gN=y+C@ 6n> VR}-BEU2Cׇ'5U1=3 I mU5*%nAk=3$Lx"*wcY[Qw ?Rk{.nꆧYKK5!qiSEeU Q#䙸wX?Vs#04L^Ӥ s]>J>' |SP&-U{vݑaOgPˬnXX$h clps5IVmaڏ5\_&E)$V{e|ϲ\7VVq}cGZzn`.-4FB%yUߑ ;tnZi cj6lr;&JJKxgc-GEEG/@0\;'T]H.hJmc ;ZCr¢'25h )RWc9W ۚu , ŀ'H琢ll²sۏTdEԲZLI/|IK-,dE@|U&"<˙ӠPh%mғ'SdF,̃Ci+Nѳ;"nWnZF1nOc89xOoA·qK}3H "bcSwI?YXq.wRǾE*ckϣ M$IC:y&~[@9r>#>I0-ǘ xw8m0%;ǸJۛYw.Uǀ셁Ew>RT].=\k#CKchJ2R,`2vΊEl'Tq)v6|wSm5C| i|SJļ(l.vq;A86j41PR>MX*6c i {n>2wi &;&8M]lдi9ΜZ7 "7 S;!;]qkM}qBJbj xQyYPλ͡6jpsAהz0Xpn2`O~bE ;μRM׳av4>?OSݍpqbO ȏJPͱ4TY1Cۻ%]'nԎD!5aI(V5[udGax.@uA2h9ɉԄZ{)ccIo,pJ.'C$BM64W83T:=kG:69U46v6T:2@h|;s4pyD&D4r`%mOc js O$5/1X>l<\Dޠ0?궠?nDzxj\jB n e%[hks洲r- DԮr;[]nV߄H OyйV4dOAt6?;ˌqu}$'to%yuu G+~cAp%uus+$Im$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$ )I$J4wrzh]ʰp RI$N2+I'I(N))I$e 6"$h0i  JIQL$OE1s}:}!)IKp4S9~!E:9))B)JAOF;&t<'2㷀S=㐊䤛3Kowh;$HN'T[I(EHȀr湢Z9IK)&L(^n*@Dkb{MjuQ.ݔ O) oR 1LM>EDu*E܈ )nRJB[5PSe{;-PS |R-gś5RRJS)JIj ',t4RHۼw* `V힣>jy8.qit1r鹳h(:!Z_7DxPǽח@1V?WcUdcH.7Pknn'L5.1Rtt̪koj=G0VtJIlu B?}Yuz-;'5fQcrpi.'urT3X@`wt.s{S 58 l3"Z`?_qlkJ-yyݷi-.iu|#,K>xv\ <1RZ4{;zèʯۣ ?#ޣ^ v#"^M[9csf3jYJom T̢=LpAVZ~)-%ڳcS<$bMظO/y~SؙXzy>^ *mbI57 wCtԝJLfJ_-G D)Z|m@ip%%1/ʈt) C[̩TllIMS`"jSsv85|-phD-ҋǬ RH tASGAm[qC{%l#UoM Kl"`UOi}q|:D XXŔٵӡO+kN6{Co;˵x3WszGRM2:ս-ƮnadIV6_G׊K߲ض<%uȣ1ϊ*4~̦ƢoKv'Y8YXgfx4&cUc;)(5hAk zFP'iVح~3~-oNe®cl,N.vO*ӎkk+YtOq*=fǦ_pGdAtٝ![Ճ~Wq滸H?]湾S@ _WoXkamΡdx'꾰[_=!gяFfFRj(~RKΑc=}5C'c!r=)ޥ_ HqnV_>3c3/~]'_#*=䃩g?驍eQ$탨IimׁﭡpV04UzgGn!vȅe #WiO-t A$/0JS>5Fd) |B4얧U^ws< ,qI+dB@e5<P[Qq'H+%:A>`M~B@(3ۀJz;ůiW?cId@gB2ěX֚Ic|PuE.#w"ϣ5gy"ƭv샎 [o&;ftJ9l>)@nc$Oj9Ѕ]+GcTlIfWy-*5dKIVHOh7+"JTIA@1JK9%J*4JWI2K=%|k"pLI+OsDx*&N㲐ưJI$F3!/1 Rh$AIXnt)GU$JJqQv%*I%]%3KQ-#TI2IBI)I$I% $$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I'h$%)$%{>ZҺ+[Z%ǂk4 h4롾ִrFCi%jS e6~Sv@F))5Vp=%pu!; LN&sTK`$'D@l7uI ۄwN fqf@h+m*oG%%wcTRqz6}Fcv$*cl#X,ʈv >(# mYs5zڱ_k& B'Y!\7t*tG  n:0 |P;DrZ3  oV_IZ"#DU@(+>_o{~#퇙!OÄ`ςS)<wBTjJsQ (HǺvN> }? E(s~hn␰xJK;ǜ(GOcA^$thyS6GNZgӡ0s40I?rwIoj\~ 5hAŭ |Tlϵ|9EuZF))dy70,LBIy虅Ǘe >T H3v>i)#eLX?uo9 O @>{G5\a]N'X]Ri4 SyNtyC!lsk@~wO3?"h!(FgS撖kLY*K9&gԡc-X<э%!fq8Zܺ۫ c%o`Vmof5NU17XnyϹۈ!ރk{J61w=ɲ_a JٔpP鶱Ӱ*P[GhyKWAƂS]" KPy$M{bx[7c*mu9*_haGU'pAUYckvoMl2եOikWsuz,I>U3.##K1--1 n3{𨶫ji=+^+-=~ Tp)sH[a mPju6_BZѧr>i%Y(6d ``8)5 p[R1_aJ#hpXulUZβGIkgyg,k@מ Q2\DςJ`2ݴ#7!4UgT5Cyv ,=ԟѪ纆fSm'q 'DZ+$\8RuZ ?4fZTTֈh'ze0I1i}K u6'!H4M|LF?cA>bU ԑJLC׏m =4uN F۵_R﹭ A(kl(&VPYťza^ Q+ ZD%kl)j]<$+0YV6;浙s.dU>+?94|J9 zeB5e d~*[l!Tǻq>IX٥MphsJAhJ@F> Ƞw܋]aj()oQ zmvJ 0W܁Ve.wV6pI ==I)45LÂOpx@~+)fC}ÕFG 2^%8qaSmul[~*YW}=\<5h0nֈFQsJfJH63S%`(= ir-Foy$S72H& xU^gQPF|+siT[IWSY~bDd"SefzL>];3oq @SmHZCC0_ 8m=Py{w^w+F:qV[X2j\6ȹŪ>p9'Y۟`>i.lyOV+cB>#@iXIhETsp![ƾ8NJw[:6jIk k~Cg T,!ŧySgֳʘkG -X<<4kf`U=Sdzom` t6<zhCJ_"A~p_NN1618jdQuTNS/ <nǸ9T6C3O0ڑՀ6I~<<"7@yYXl%r>D`[]iPNr%Lym -Xt $xV՝{B 2l`%e-7<<`4ڲf_l ,>x+- J봒5oe8~ )n8<7nV(qu!:'=7B5AhtNy :`%0 ?R5[MB擷Ftm|: V9Xa:ڛ\tiB_) VFa%"w3RHi[#V2S,{O+)"k`I3= eg;j vS{FZNJIo}ZEcio~=Oȫqݱ~Vq6y^LZ}-Ho?Dc]d6t8I/cǒθD8;vg3&'vG j$L *ꏩ쪁7_A}y l> Va5+N~)#R5]-uAz+2s !$ս/q q#$kZ}n08u1 ~uvʜvY¾ø\Lj@ŎcqhxUOhngmТHkG1>+cLnp arx^d fdP t{Vp:W-=&.oK9REwGݬ6F?]OJA@\5W\Lχa2DI؝铤I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$U%RI%0fC5Ӏ\I$$ErI$qP%)$Hxk V0B!aTR D 6m{f'R:c<%bɀ߽ #OTlpnIKnR Lry<"Ibx$)L'mq|ux"O'%%,D64N)k-]S:X%).j=8H4jʓN$H!͑'a 0cCt' ('S 쒛htQx'R ˘5%-RKt&Ů0 @O*d!%/K3c @M'xNaCi'ۡIK K=Fmd6ޥOQuO:&Ʊl'@d4nc$>J׏#sX9#]^76Oe*OX5En-2]Rfg$5++5)~;q?žhwX }y#P _{m{li*iQ;ճԭ4rãfMVXc