^ExifMM*bj(1$r2i-'-'Adobe Photoshop CC 2019 (Macintosh)2019:08:26 11:26:23  T&.(6 HH Adobe_CMAdobed            n" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?TI%)$^nӟgU]I`;">*$F Q%]2>W@'Z+_s{ޯbt[^:UK.>OjVri,wo1x ,1$I I$RI$ >4<)UgOqc#Q&%3 U.Q3.k:xoNnao.߳AsisjOoЮok 9%nTyC6XLRGǏ5Ir6f l">jTf ZF4/wjGt|_+;ת\-Dƃe׏Kt7oq3df(a֏?wKWחSC.mѶ'j 嗲^63XG!W< xI_F/3y1{\5Ez2솟sg^5Mk~yh88uW׌dUT6woY%m1] 1 kri@ὑmWʹApRFpُ-I΍TCZ~ݺl _exI?+"0m`p?Ȃ E0Gx-N͹c}V3>QZǬ0} GŮIXZ ٭Ilӌ߁ԫ ~3m]_oeֽEZOmsBݫq,ms? x!b^(Pzl׭Dze2]Ne"tԫʥD>xeMLzT/w"W iR,o`. ~HVұښ^2?OMl)jk^֖>-e^֟LӉK>g@̂A AgH^&7ŋiC2Mq/;B[-/r?stQ}Iw*<4r ȘކJ<,26F=߼|IǴ ,wzym/HS[Kr='HC9}\d2VHDŽj8_ޤ\Zl"0k~˧RV+u lqY,>7jX n{ ?*X_G+^ǖ쇁HOYnG /ѭȈ0g3w#Quy_ZUizM}Khۗdǥ{l*qݷhyοX.kwZLM ν%7B7FWo)7^ܗ1"Z"V?ͽRa-wESs\!mm;d.~ 3ء׭7c_[W{1g46ֆ1pMn,ߢ "FvlVEƾ cr*.ڇn N\5,`+ﯭT7ZܚMl-se۵9JI:2{@#ܝ+U>l97 'sk=?v귪G[ m?~jxơe;'C}{?Fk= x3y%mY|eCS`mBN6gుaCcGK0QUefTlweM{}'Wo",:!Yz_gWOL6a͙6cΠ5!zg _}DWL7e Izqubzj`c+kѣ}`l}a.U4 OӰ9gd5cyaG`\<'vTsOjiy1(K/SD~,/9Xf5⭻lz9y/W7 kn@nwNᷟ)V5_r2}c~fKن _}ićX4T~b$=a>9X=QԳIcIM?=?NZ&t!JF}g2c~/}z\T޾b5ήAf9..5W0\cf1p} }wWF,KɏϢ[!SBd^6hg@1-f֍q\Yce@Ӽ[&wX\{riǸ4eTDt g[h\+xT󰟖M/(~V'(tMvς@f3$P]VW?{v,w6?_,E6Ux*"2?֎uEps9m^_T] qX3k74;߯[U黙Dv?EorBNjC):GjF,{/vU-xn642\)VCA=~C^TޖթX06[Էx׾7mS6b d,ctm0]qs)Xb8>Xwe{Gy(じ5_ycF_W/?]3";eYcfǃ{nПK?\QƏNcɛ)W~f֗yc8ɏ `}?!^GK]4~s,ˋ2?eʏy (YMV,`pp-2&Zyj&# ?y;emqm:$ծФZ6V[Xabe&.Vܶq\Y 쭻s, }w~bsexai>k}Lt/?ͮakd>F=Vgwr]S}q2B?;gw30` nδV kP,mYɞ/W,G/p}ؗWTK f}CxX ]kuC[-qKbp867zjHs#buw?YQ(7}쯪cif?ۤʧODzo`5&hc7N}mkncMq&] ~s܆ۘթ4>p;=RB\~~6?V1kTӿG2tqN t 6Ϳ1}̂ϥ[Om~amdiYg~h9U)meAH?0[^u[n#6`5k1k+,VEeapm?9P:2Mc;L6c5wmJ"7?Tsq;oO?*+} j)`29.0rs;k?X7d ڿwInWC9Fw{v46z;Jكn)WNH{ \\DAэgK>c,c#`Ebpc!l$J6TI%)$IJP}U=sk4 SU:m;~{k7:%O-m,Q0=+t Y~Au9<K+XsO@:x_TWW}j_=G4TI%)$IJI$RI$I%)$IJI$Rנ.pռ>?Qi{k^GKe6ɏ<?f1m 0#7l1kԶz_U14/^W/'/&Ցo,:H7PߴzGzOz.N掏Photoshop 3.08BIM8BIM%\/{gdպ8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXTBrother MFC-9330CDWprintProofSetupObjcInstellen proef proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM Z8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM8BIM8BIM08BIM-8BIM@@8BIM8BIMU T workbase_foto-11 TnullboundsObjcRct1Top longLeftlongBtomlong TRghtlong slicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlong TRghtlong urlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM <n@  Adobe_CMAdobed            n" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?TI%)$^nӟgU]I`;">*$F Q%]2>W@'Z+_s{ޯbt[^:UK.>OjVri,wo1x ,1$I I$RI$ >4<)UgOqc#Q&%3 U.Q3.k:xoNnao.߳AsisjOoЮok 9%nTyC6XLRGǏ5Ir6f l">jTf ZF4/wjGt|_+;ת\-Dƃe׏Kt7oq3df(a֏?wKWחSC.mѶ'j 嗲^63XG!W< xI_F/3y1{\5Ez2솟sg^5Mk~yh88uW׌dUT6woY%m1] 1 kri@ὑmWʹApRFpُ-I΍TCZ~ݺl _exI?+"0m`p?Ȃ E0Gx-N͹c}V3>QZǬ0} GŮIXZ ٭Ilӌ߁ԫ ~3m]_oeֽEZOmsBݫq,ms? x!b^(Pzl׭Dze2]Ne"tԫʥD>xeMLzT/w"W iR,o`. ~HVұښ^2?OMl)jk^֖>-e^֟LӉK>g@̂A AgH^&7ŋiC2Mq/;B[-/r?stQ}Iw*<4r ȘކJ<,26F=߼|IǴ ,wzym/HS[Kr='HC9}\d2VHDŽj8_ޤ\Zl"0k~˧RV+u lqY,>7jX n{ ?*X_G+^ǖ쇁HOYnG /ѭȈ0g3w#Quy_ZUizM}Khۗdǥ{l*qݷhyοX.kwZLM ν%7B7FWo)7^ܗ1"Z"V?ͽRa-wESs\!mm;d.~ 3ء׭7c_[W{1g46ֆ1pMn,ߢ "FvlVEƾ cr*.ڇn N\5,`+ﯭT7ZܚMl-se۵9JI:2{@#ܝ+U>l97 'sk=?v귪G[ m?~jxơe;'C}{?Fk= x3y%mY|eCS`mBN6gుaCcGK0QUefTlweM{}'Wo",:!Yz_gWOL6a͙6cΠ5!zg _}DWL7e Izqubzj`c+kѣ}`l}a.U4 OӰ9gd5cyaG`\<'vTsOjiy1(K/SD~,/9Xf5⭻lz9y/W7 kn@nwNᷟ)V5_r2}c~fKن _}ićX4T~b$=a>9X=QԳIcIM?=?NZ&t!JF}g2c~/}z\T޾b5ήAf9..5W0\cf1p} }wWF,KɏϢ[!SBd^6hg@1-f֍q\Yce@Ӽ[&wX\{riǸ4eTDt g[h\+xT󰟖M/(~V'(tMvς@f3$P]VW?{v,w6?_,E6Ux*"2?֎uEps9m^_T] qX3k74;߯[U黙Dv?EorBNjC):GjF,{/vU-xn642\)VCA=~C^TޖթX06[Էx׾7mS6b d,ctm0]qs)Xb8>Xwe{Gy(じ5_ycF_W/?]3";eYcfǃ{nПK?\QƏNcɛ)W~f֗yc8ɏ `}?!^GK]4~s,ˋ2?eʏy (YMV,`pp-2&Zyj&# ?y;emqm:$ծФZ6V[Xabe&.Vܶq\Y 쭻s, }w~bsexai>k}Lt/?ͮakd>F=Vgwr]S}q2B?;gw30` nδV kP,mYɞ/W,G/p}ؗWTK f}CxX ]kuC[-qKbp867zjHs#buw?YQ(7}쯪cif?ۤʧODzo`5&hc7N}mkncMq&] ~s܆ۘթ4>p;=RB\~~6?V1kTӿG2tqN t 6Ϳ1}̂ϥ[Om~amdiYg~h9U)meAH?0[^u[n#6`5k1k+,VEeapm?9P:2Mc;L6c5wmJ"7?Tsq;oO?*+} j)`29.0rs;k?X7d ڿwInWC9Fw{v46z;Jكn)WNH{ \\DAэgK>c,c#`Ebpc!l$J6TI%)$IJP}U=sk4 SU:m;~{k7:%O-m,Q0=+t Y~Au9<K+XsO@:x_TWW}j_=G4TI%)$IJI$RI$I%)$IJI$Rנ.pռ>?Qi{k^GKe6ɏ<?f1m 0#7l1kԶz_U14/^W/'/&Ցo,:H7PߴzGzOz.N掏8BIM!]Adobe PhotoshopAdobe Photoshop CC 20198BIMhttp://ns.adobe.com/xap/1.0/ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I+Xg?e-Yщ.%9qJ[F*I$tIOm3Dw6\ty/yqI$Z}G_ XbUrb)ppIL2 x$I$Q)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$e`ǰ~d7ZE~Gq`ɛLq3geke?*I$2JUg.ݸO# GpǓLcqI$I1bI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$681`|j1$Ѭr9]t[I;mSXrë/$X}{/%ć7n :c qwZs3s9.#9wRI$hMz|Շ׺xȆs|y Vmn$4k$ÕTd '廧iv9L!zOɘs\R=ᄿN/I$I$[I$zvMuu4SI`TB,FU߅aG{I$DF%I$NcI<TI&I\0*TñSqQK.QIE$$[gHx*||!SAU sOI$YAkKO:hTI$\{õ;]TI&I#$MU Ӳqks['s.p2{Y8xe>$JI"щvI|hF125{$HI+VI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$\-ﭿSpGg-?I%$\SfGw0g2 |8%$JZǪX46}f)⫛h W(?c>_2)$]^_ժmu{GGJ0A^IkM=,>T X.1ZT` r=ͻg݄qOW)$]>/ٰwXzEvVr8jHtrnZ{K8?[g#>_=L{WRI$էzPϴ,UhKj\2#_n#{I$PtȢsGֵQo>wb_sIqJLxdž,پ+̙n^8Da$]ױs?.C"c`N"ض~}ehlNh98r{sdHyXsDpI%I,I$I$JRI$4U)jY?c~ߋkti$Jo}nzʰSDY>%pI$ITh$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$\-ﭿSpGg-?I%+G#u<*,P7b{Ȍa/ޏI$_.ZIZ*z'9k}o|]}Z)9L/$|71354IsHؘv?ӤK'W]ҪgL{ѱS9qdH/9Ts9Ŏ>YQI$O44jJ./6Ǘ|aV)O1ʃQ?zY5y~8ϊJI$wz{z}^\\$>ku?u_Ur?SsKPr%q"\0>U$K-~} ~-,n6&p"ca"I%Mm}SUZ[_T,Vr_yV?$B4U)jfՔ??o=JI$kWCRӫ귏oaBI` X.J߈]oG.Oϟ?ܼ#I.A$Y:I%%]~G?[/(I$eп|UbWeп|Ub? z_J 5$K]wog}V奔  -7 )$B+\mtO-Q]sο.gGu9k?II$oI<]5!a}e 5ʟditsTH#B1 QC[sˀa/cq$I$T\$I$I)I$KWW,ghS~-GӏTI+?[*Od'’I$I%QI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$we+g?j9qw}`3}~9,XryKd|;#>_1&IaifOGԆ0@GqX?z?RI$~`:D1ڭ}o|]}K}b pcN{@*X3΢DKgVÏɂxg9~Arryyls2Gs䟹ԒI,59,6K|Z>Bc74L 9rOL3GZ_ S2|=KTI,r0yIvVΟϪ$Xy _LԶ48Cٍx8E_=\x_I n%W#*pvI2=IuAqTqx>(d,a^pI$辨} ~-,n6-OTEk$7՞2s-.ЍB%^Rts@#N^1I$KwYb7FKk.;{ʿ&@y9d8ԒI(fՔ\˲˫psvA%F䔒I-KN;Zʳk}5t`}Zr*t!߻96›?ѹ#c$K߈]oGrUp'.ebc@J\u1z  qI$RI%$]~G?[_ABc7Mw \:7QLTI$.&΍_Occp?Rdr~_G<3˳n;#,3 ({9;(I$I$lJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$Um`\[җE&c1j,}tXp⟨_:lg^ Ic8RI$w/ſ4w/ſ5?yyK~?,y^ԒI,oM/oMk}wREE?+{gRI$w/ſ4w/ſ5?yyK~dxg|I$ַ,}/Y_\?o⽞W$K'o[Ko[Zhg;)pOy^ԒI,oM/oMk}wREE?+{gRI$w/ſ4w/ſ5?yyK~dxg|I$ַ,}/Y_\?o⽞W$K'o[Ko[Zhg;)pOy^ԒI,oM/oMk}wREE?+{gRI$w/ſ4w/ſ5?yyK~dxg|I$ַ,}/Y_\?o⽞W$K'o[Ko[Zhg;)pOy^ԒI,oM/oMk}wREE?+{gRI$w/ſ4w/ſ5?yyK~dxg|I$ַ,}/Y_\?o⽞W$K'o[Ko[Zhg;)pOy^ԒI,oM+ԹZLL\>g;*i9ēwX_ Ń L_&ac8 I$8I,'1I$I$JRI$I$I$I$$I$I)I$He7ys1ꤩ!IJJw/ſ4w/ſ5?z^OޗdxᘿRT%s_;_;}Gx/Q'KWy??_*HRRoM/oMtOޗ?+7_ys1ꤩ!IJJw/ſ4w/ſ5?z^OޗdxᘿRT%s_;_;}Gx/Q'KWy??_*HRRoM/oMtOޗ?+7_ys1ꤩ!IJJw/ſ5JUB+S\^o~F\#Le.S!2`9q 11P?ЂT2$K)II%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$?cŏ]X67XUq5_sJ I$I$u$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I&k?u5K?iuɗI.y$\sI$I%)$I$IJI$I$RI$I$I%os>rZV3)_&'5$Kw';?˲r2|LI$IbI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%*~!s={uj~!s={u>1rΈ,QP(I$5$KI%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$?cŏ]X67XUq5_sJ I$I$u$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I&k?u5K?iuɗI.y$\sI$I%)$I$IJI$I$RI$I$I%os>rZV3)_&'5$Kw';?˲r2|LI$IbI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%*~!s={uj~!s={u>1rΈ,QP(I$5$KI%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$?cŏ]X67XUq5_sJ I$I$u$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I&k?u5K?iuɗI.y$\sI$I%)$I$IJI$I$RI$I$I%os>rZV3)_&'5$Kw';?˲r2|LI$IbI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%*~!s={uj~!s={u>1rΈ,QP(I$5$KI%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$?cŏ]X67XUq5_sJ I$I$u$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I&k?u5K?iuɗI.y$\sI$I%)$I$IJI$I$RI$I$I%os>rZV3)_&'5$Kw';?˲r2|LI$IbI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%*~!s={uj~!s={u>1rΈ,QP(I$5$KI%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$JU 01hRc< $ɋY. t;  'I,C6',$/;c5L  i&SI $I$I)I$I$JRI$I+e2' Y)$rTEk~UhVvN s H pEՐ6SQ"8Z7B{^%W.ǹRˋui09%ꙟP~KUg<x׈}%_UOݶD[-qݯ+8ۂ2e=z W.K#*>Ua>BRF» Zؠ`ޡIB[kw0*i$I%I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$?#ubc1W]/?~gq()$I$S5ԒI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$ɬ'M? /l&_2RI$IqRI$I$I$I%)$I$IJI$I$RI$տ;1i[σ\<\ԒI.ܟdS.E2r$I%I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$mGjmGjQis'Wq:!.9EB $XԒI/I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$tYi4J.xh`()V ->ݮݣk~e RGDXLL UmOZd%mc}_GBOmsfN<i4K\esn,xe*¸<2wL~gI-xJ!\GتWDeк}^QZNxhB]ŬV{&C?r4D?yi Ucż#7@R>%+h}& Rv% [(%𺅉\梂DҠJsXvr]6|]Ci5,L^VKw5 pb[.%?]G}Gac),F{u WW(qw2?kd~k0QK̺dcs"$KG]ab ,u(<\Y̓kv hNBRkΐc?zpVSYx aKԾ~d'lkĈ"I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$IcZ$JRI&$'t?]_WkkGuS}=9\!LyRsǖ\2\ǽj@xo^珡|gYY]7'չ/q=\o^w4If'}' 88O^DF^o*}[!h@^^]6YO/E.%FZ7|JУjSlwyEky ,7kɏnAyOjz&U@Z؟T ںCZ=ګ5౼1=?D|]KypT:kэ "u![vn6t^>tM gj-E7ڨ=ۭ$|Q p,phΘ ~11w'FA)UЕld&$t6? i&˟!ZzKn& YYV~qt: ,=nMn\vZ[IF?#-9Wjt,3sKO A,u[̨twm@M (_)(ɷ /+șUdJy#:3{"crXy׻LˊLAf; *$XuDd#a 'QA/I zmSJSx\Ep'ɵLaG` QkcTKRFSRI$Ktw)6A2H)5Р%jvuVYV1?$aaOJ pQ*㻣1!>QsO0z[JSByt;JqpP$צw;pn $Ƞi%|l7sĀD6Jl}zԮeϳGə=I="~{ :gӇ2F1zZ:8hlhV1'ru$vz}_J ?e3V^Zy '}vgnmLdVxp4>JPmgH}?/bG1 $XwHux忊[Wc?4\%xJ䴩RY)+虌AwNo5)Q컈eGEgWI| %cO'$IKI$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$?cŏ]X67XUq5_sJ I$I$u$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I&k?u5K?iuɗI.y$\sI$I%)$I$IJI$I$RI$I$I%os>rZV3)_&'5$Kw';?˲r2|LI$IbI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%*~!s={uj~!s={u>1rΈ,QP(I$5$KI%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$%Xb9JJRI(`K_R/ʲ ZnC $g ˁ*u\pEkisϞmJ#@xQnneoW6YeMct|T>K3&d;y]i @Sڡ3zD4JS1 5lʤeI)RRmd#U0L$Н8AL|}ӧ)4)؄Ж$nI:'>DR% )4&I$RH>i&ߔМ"$}I몑 Q"cI"RLR cRoq?me $)bnbSNuÔ:Z"cB>i<TqJS{R|cLt%.4H<$O DJ\pYS(F$%:J\8Q>!H@I<&쒕&|5e0:Oe~)ʏt)fO}vH<"D4JIp1?Ԧ*IlBb%)rQ:R)h5I/4<j #D9LRR4 {&'D7d&gm('p?)8dؕrWSi mz eeoTd4;.'țhKGg;~ ?(:8Z`zɷdV7xF-H5b]W >MR|v8sYG9m":UBu ?5ɟNG[.svI>5Þ?IZ)~ٰj@TNa(\oyTm{8p^TSO!Il[<~#o޲NYpWvXപ}Wg`~kս@VH {fXHl=wnp g^n%/%W*v9g zpg;6quO'Ƶaw-rycO/c%/B,iż&?D^BϪT1FFSw9լ"d߹jRC /0*uk\8q\OY=̰YrO=Q:kGx.|R,=ӛ|4G7Ғv LuK;Jt65\ž'g*f;`ۋBoTOs#h*Crg;s[']׭NkгpO x: NO3/ |O($6ujV]W}H:it8%ٿW:vp>M 3 ߓ<{0I^3gIsu]AN}mi0u}Dź9*`Ar3ĉa%ZE8tV$H]$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%Y,~F*şѱb_t:PRI$I$k$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I7XY,Nɬ*_sOLepIs$㜥$I$I)I$I$JRI$I$I$I$$I-?әwKb9ԹO??6y?N/$] ?]?(d2I$KI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I)U ӭU ӭՑN/tCId\r9ETI%α$_I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$ %{~OХD H2w )$ā )g. =%au+g^b sB;0+t :mрZέi 5y|b[ďNωURhy 5'8vȮ 鸡,J.kX< kd5wh33Y|G4]j'k::1zX8Sz~>qݪԣQ"5 J#GrՖ|"R*o$JvM !續Z'&4`;O*$vM N 'NZBCT'R6̔RI/$Ȓ97?Ꙡ])NI28_4%xJ IKi\% h4BmQJI(=2I0IKa" h)vNB`42&Ri=):hQ 0IKDwxQ;hJ!I(-K%FӲ@hN"RRbe Dt4#DƩ$ה1֒"SII*PRE/^iIK xLuiLe<%Wx-IHd?)IVnpDʈnHk|N飺[AILjIRJI[ BS1TGe-R AO J O1dQSh aEw%#wtl4LBVe1}tP|懴 bBV&aÿ)J HE<4ф v<,oq/x. !)VSzmBg˪Jf9iIzzÒ xJNO5g?E0[.;~͢ N8&wLu_oVpqלY/s}EL4B!(>|K(߄6:O,nɬjU;^ŵ1c{h #P9U;@sWb\Ϥc lv;G܂Mm? ٔ|Pu|=HXFW$zϫ6sS~Nߩ>̏x`Y#,Gq ,}g\/-Iz-PpKT^re{$GRs mR]}Pߢ*w}Ig Ś<)m 餳Tjl8׷e*.[9p̂q;IUoQ)ʏE%a;% |:Hc"Çޤi'-#2I4I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$]UѱbY,~F*C9?%$I$JfI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$u5b4͏_ I$s∦NS$I$I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$_M:߈]5_M:߈Yj??d9D?E(CUA$\I%I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$>>'mL.?MnP}f $ NhRLI%*H"D) iI' R3t)J}t(IKxlƉI:&K$Rǂ]1#$KǏRLN$#Tu<4/4E)EKiO);D$xS'I%,T'Q $RxZqwLb7v $%.bc'堤d<% h X G)-Nrm򔤒\$!Z~yI$j""S4 % òS /vBI$d@'$:#_I$^Sh4<屨I(K)S)32rjJW<rSF&RU9R(p&zQ)=)BP TJR#/48*X%@nɊZ')MOR|B[e:4K"n B"JlO2taVޘ$-(KlpزG4d8nhSh3|vUopBÕ|0ه9!P` }LQ?B,UXWc?ں1H: rc3lZNJ=}Y}"d=רP6 +l|ПO#]?YwzF޸㩈\׮'4$,אOX>MiDzy=*̈1ǒ00U9V滗VzA+yHu r Aptla ?}&^P87 N̺Â.ܲuDGO5z3yBM4|vzi 42pH>Iw/x*}\q$| i%4KФԝqEgQ|LT華 T8G դ$U rqǻ:{!jkªhs?[~UQi3[ģ)T;I}G8SB^ͶD>Dȡ5! L:IHNJMpe .%t?&vCԦq/1!$.('(~hȁ*?Gnqo/FS0pp5 hʼЉcMXUSmw^$A)-Os∦NS$I$I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$_M:߈]5_M:߈Yj??d9D?E(CUA$\I%I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$-8_IDI%}"J\/?G+PͣFL7,r2Iu~CPX_b@fұQ&˾L?Y{ nyM])(%s|O,vlΦ\[b5纓[DOmRL$r "K@uLROdHL 4RR.R))e;9 Bp9AKGP$R$٘$)%1:$@'Ob$KR#ByH{t)DO'L%(9si) B _uMRLI$pa9QA$E%(ԨyH5)PH$=HRv_A'L)L1d]BM*QDI%1B@2D $I)䗏u #1Ӕ))q>O#$"LS܄8ALDH4>1iOʉ )n8Q2;)rtNR*XG%#$BnuIJ"e4A2\% R8 yT`x$p;PR:JDqS K*\;ptHxI2 Q2'D$ S98 %)JJbSD|ϊQ %IJNH:uJ @$RᲘ$S 'J%%(8JIӪ\%RmS)t$H)%:MT~Sp YI)!8|IBRϏdGu)i$$Pē)|:L I$Rh)vxI(:dސ&e4*Q %Q )Rgxx'1)qH)pEK4O ׎RIBRJ[I J`4L $>~I8~)&%/:Bc"G-r-S))C^TgM.#:w8JRIK;S}.T J@x I" N1'u'$lÝ8 HRJU$@ %JT?*}TM &%&DH&C/$s0ĮMܫZ&y@|d:M|ȖмU6xܑ+fnh}S@!=2utW#z{N1k\}/xv0hLߓެDoS+ YM-?l Pbz*:j2?e 7z!{(~o;zAs)niSH&^~h*Ҭ}ɧu N{xwVGJMFc]b][smDL.5%n?E ~d&Du J>@~h.Q%ҿx;O1:C=¾UQ*_*?r]u1'}M?pb?)*oOZ^Ώ_ӥ% z vOհ˨pRxp4EM#!L:I$q쾭J-mu M,+-iaq>v= nip}m in|>bR8پ%NhwPpz}X epYլݴRZT\!BbFvbxnSgc4;s:۬5]OH(Il\Mq>A)ͧ)K'0vy{+tGU,dBd~`Uq/OS -w=DmT!V04ysE4JwiFFάNTRlyR QRS9MaO ΋8}i\*.3ZHsKIyiBuwkt xs୦I$MtI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$]UѱbY,~F*C9?%$I$JfI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$u5b4͏_ I$s∦NS$I$I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$_M:߈]5_M:߈Yj??d9D?E(CUA$\I%I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I)K;XNDVZ<]N0DGI&$ NS_.wsi4ޟC7;ڨ@uOanjUͳoޫYuL%;oP[i1Ŏh])kD {ys$9>'_':fWO&OU]sTw+4 Dž15+IKrdHɷoU *?>i(Ec?#E ج%i; AW-৐B`; IR"f@)@LJS=% ڒ,).ST'F]\: Q߂rRSĞH %9)IK4|*G44O)&N#S:a1d%I!o/Ȕ LHtL$QH|LK& IrR:}Dp51tJ\h'Ħ#T&:0;a4{$)$I)i'SSJ\"> 4I$IJ␐tKP)h%.SJQSJn"{&I$Ri$cTt\$$)̝!(<{=yP 3:1`O |RRh&Ru쐑d铤&T (RLڍ|O:dҞRS2JlM;rI$j% ?H% 5 JbStڔ9 t!k?$JRS3ƩHBIL%))c &4M '))aiR#H$bJQFƆ@RDI$K^RI)I%,xR 8J#_H@hL$27KH%+rhS)n!:i (:FNوJS')%,~!dJthRtײovi<$LI.Bv##q$JIKwH9 {#2xHT<;fd?4rI%,{-`&pm $ArGDI$#' j_2snRRRg!%DP:L)BrRHRa;aHN%IS'XKI( %䒘LBHN$i: DvI<9N% 柁# LI)b[H:pHtI$R%>=v$JJXk)A"G2xI%-̎>>I 8I2JTJN\Jg$IL~)J.'JR.RiArBhВIQpA1d(I(EJ1<*22Q%(@0xREМܚRI(IJۯ_s H<$$[RHSl)Ɖ"%01D xM(- x4{ʉqYn@};U!H1Э_136sF:C:(yq.ve&!wX bX{(셧fwc-g/9E (.GMalYE<*e;26J3]dxGBe@ Pb!wU7wX>*wWؙUԒo LjlnmE-)`q ͒d*n^O&!!!lg5Am)"TMAL5o.Uv橗颋Q9;1@1ԚZgY1 =Z3 +.BP҉LqGK:? :Nm +XbK]Ev;e|*Ο cSxR4<#=2X\{"7l%*;Pb~컲hlJP%0L * Co.%ݜH*1W0 $"28ܒ<$8A"TqvQ|ӏ4=q/R0$Kg$% ZƩ()nQu`Fx#NУ'U4YiߥC>DDدgĢ6?z0S䰙Gcj+^}0t32ڧs P]PLL|"zHpqS$Yo8kOmS&9D }BI."9(R"|T-UX'= c8RkmnxZZr @JF^ 1h ,`LL"R2kxRa"QC䪭!)-H@Ϊ̪]S^XOqQ0>okDYױ)0+jm­_GekFUktBj9v ]]vg6yf/Wp[ݹ{1fn~ۮ1^jiCP՞ 2FgPctտSBAX!Q˨R =%e3*SJ{~H'ZAؤIDX TRJI+I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$<-UnZ)]z'M4j%E<&sxG'RJ^}x8f?cN 6 ~uqCݟ&~ FJBߋS}湍"H '"fӳ`~Weӭ<|b`Z2ϙwӢ-p>`PNk,k S"ueGp/sKt"/b=47nb;YKJyX8e+Fap)-.{3kk%#PaJ:g Ԕk_šI% xErI%5;*c!V︥hԒiJBJz>cr#~绊_!;9 7]%-g[_; C|p7?d^V2K/S(Z>SNX\/LB7y9#\rK(4,qh3Oo'yc'ˎ)UAM븯3IzUP{8|?>كY5 r1 Uؾ!)Gn&H)6;JRHФo%I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$IuVFgloj38I$I)I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$M? k?6?/)$\I$)I$I$JRI$I$I$I$$I$I)I$KO|R嘴Ng.SiMOӋ?jI$BO2wr~)dd"9LI$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$JU}6Bz~#5t}6Bz~#5d|cYQUIsjI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$aOJRI&$TRZVsS=΋/t#4&Jq'3 H6eL%YS[-Xgm,.>Azf A7ڭq+Em AA.j#mZY>)/7kkne מWaFϾ V<ΫLɰuO*s3;zZ9>#{WRΣ[~JhѵS'NLpbtl\AڃxS̝NY%-I%{-}*wd"l%j)$]<ЍyH'LDq0E2'@d$ऒ*Xdx'8t2\$e AmB@28N$j5))BvSN-`{FݠM"cT:tBFv\&:dZ:H@܄@< BxNXOeN :+v H9%nna/*D΄-V vdP26bp\N<9í4g`_x'H"J-B,Zc*cW0Z=զ*.<+bx0m b9dٴY[v8 6wUKRڬtHa8$#K,#T^{aqU}2qEhT)6;}1ʰxTNr#,-{ݣB U]ChΞ0Wv'بϞ- R\Iu>'{ 02W7hWn[ j'K$b9 6i[xH[aKh4.28pK`KIVSl<xKq-Gb})y$SmM,hKr}کnIGTET0 Z b!-O0$S &hIӲDN IL;)ByI4]8L@)RLJaKǚP'?)JJX{S$2Jbѡ!OE"R@81( Q,?%Zϩ1Z>JSYsFҗ}Z8rn=!s}B᥿U;18~+%0OAՐs>~H'jYcLgq 뤲M/ou)/KOU{?!/xN>8R>JxO.rK~)63Ֆ< ~y%IQs{DAg~VR' >#3e$Y2=BJ:KYw31axN%I@\ APNZG!2+I$I$RI%{ eX=.܅]Wr$)Hty-J'G88ʒI% :VQOTI,CpҠqV DƟqI$sAQ-Q8w #Ʈ0I]NQeDH+3+5Z{/.r߂NvUF}깉e䌲pL~Q.dzm5^ޥ-c<BԎIk=FȭzxWsGH2Hn s81?x[7ஃ .&H%jΕfS-Pb]ONԚCiyR#jPeMZrDDF'M# ~!R&a:)[ۉPǛUK*);o{ze`<5j8DY?!"6*IGbB]!dw(pPqSG"PRt;I}X^ ebV8h%!"qqF7$@F%N+ E$,ؐ*:bП>uR9"G %o'U ԸPu^ ?i#컆G\ZTE/oMb8&&ZA%NO@d8?rM̤pDkZ斞 #e AE OdwPBtՏѿQX+>:87Z'NYf9FG2 ytI%+qI$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$?cŏ]X67XUq5_sJ I$I$u$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I&k?u5K?iuɗI.y$\sI$I%)$I$IJI$I$RI$I$I%os>rZV3)_&'5$Kw';?˲r2|LI$IbI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%*~!s={uj~!s={u>1rΈ,QP(I$5$KI%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I)K0IIJI$jT[S!š=ܺ~vAG,字ŋyYخꛠ2|Kwy[K2bY^ұc[ ys_?L*Ω>K9/PyC`< E10ViC,җW?'7'#]/?DBe~%@ A@S'JDs3(M)Dp$( #'H #⤐2A%0)'^e1$ $04ΪZw&O $>j^g|I$‘&M)J-zhN qZ)N%.A)mAh$)"N)$ΩI%(7h HIOd%.:& rxI$AK<&)ΚI JZ PN?ڜJIdHXIঙj$IK8hu-?)JaHx%)JI$!)O<0ۢ}'DLǂtJdSGޞ5O|$I)'R3*NQI$GFa9>)??)HJ[lwNȦ:'de8~)i҉L;09$.R:$%:HX ڂ<O4%Jb=څ() h8R)%%#P}l Te8qOxA4*8!8!-MhQ?)AVʙ jSphNt*<(aANI(&ǒD) R)-жaVOMJSAI )Հ% 6t=_S%2yI4$OyvU{;V"0* $k)Q4Ljۤ ٯư>+O" \^S-#ʳnuEB>Zqz>[PtnVc\W$tVhJeI1*yNFއ:vvF4+5(C\6Q {T ~`P:<ҮTcI> cCtw`DWlDV 1cY)#Pjn)dvO 2'8T7)*裷lo#raKxHە2uM$w' R:jkTI4(!|S*@&%:I$Tiƥ? 4(N iA*7LJdɷ$xN`SA>R!1 "S)>ԂR*Q'OiK% TH)K$BhO )myNI"7(Q0 .!)Hj)JJZN"xJI): XHԥ dM#̬ u$''%ùsXQ45܄x2u<pY@eޓ!8Ag- WD,]%˜ Dn[%qf w>ґDf3տ)U^(jUa;Ç ?C,PHD@]P.[CSBѩ>0‡_$yL˺KokG*ZrNKyOn,TKuX=~G!7S PpHP䡻QpAwJDQM%&.% 7FwuZ&PƠJ4Ѫ`;uRW{nG V'!%׺}7T ,[b)8L)0:Cmc.+bF[Hp-V;Hukw/W'#!sIzWQh -+#.̜&aAQuc@acwު?2'~FudՌ`F je0ƎM]K*jFמIowL+ր$CYMfd/jŧѭ&`+86̢5>лLOrcA^%F 726q$;.XcOBbP@( *y04x+W;Wm/Vu~ s]qZ}-;k&uzm+ȗu<2H?I˅Si~XT^zЭ:]ݡI$o$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$UgloF9?IAI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$cMgo:n&7X|G?c2’I%$KrI$I$$I$I)I$I$JRI$I$I$Ng.YO|R?+?8It.S'w'vNFOx)$I,RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$Wo.gN?#WMWo.gN?#VG?O:_%q*PI$:ƤII%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$s4I[];^il4MnRERIlN0+=T.E kjl1.voB:cB"grNc_+|鰺66 kgBI@$|5 0G*BGH  ! <ԈN윔LS.xjDuI %R)$JHJR xi" 7 pJPR8JLH<894M;' cj)iN'$I)h@R>J09 $I/1qRKS'DA>iS)JA"PS –Bre JI$ۯ]OL7 J_jI4%6˜j@)K2IPljnR$-@I <$*ZvH )!Z&q JIT> ?Bӟ2\'b@'R-yI2\IL )~TS&I$S(LIӉBs`$$OMg&()hLFt蜤HԇqĨ &I:*\mܥd&7ySNE2Jc<&$R=I% %0)@!$-!8jE $)/ʒI%(h=Jrb:% $IJDR- dޒRH)r}%;@2;%$ m5NAAN\2JREKl$R3 rO4I.RH$hDB4NIL{jRJ FݕAd2쌂d e=tx]*O>(l'Amħ:YHU,z_\0<;bbĭ8 Ą! ,jkZ˜yjuL44$RVv7 &uz$ IyJd%2ڇy:O)4NiJe%1t4HIRMxL@JRAJN L*R&ڜ%(RڤZ!1jm)$\9>M iR$V!FHIB }TdVO L6*N5( $+U!.D鉂X $f(ςh-I$eOd&"y)@<'$Oi1 S"Bd3> `Ȥ 5*:M e.u)R )"R)%\頍J@x&i$ϒIO"'$$ 4vL @-)ȍ{'I6RJe<jR|T~R׺}%I)a~ȁ24J$a%1%*CM P tr%-ƽ0i$j )QZBM$JJX'xi4'!8 )@'L4Le4jpԕkI웺@ r-ybMbv iy=Rࡵ>4UR.<&E >$U Oܢ'l I$VJu)sdBm4)$|SM(I Or]3 $!bLp5ײh<KJ}.J\htɑRUT/2d"T <)&&KJJ'St RRU,AM GT|)J^ILK{ďO FRILHSSrSr4cI94%:Ra"S&@OdS9K*IŒ (a"7 ƩH$R%-'ӪԎ'I4)!`I0)lKoJR5$4ZRI0 JS\rS|Х1 $3SQ"|U|*rFX<ǿgMϦt 'Ŗce(iFd;DjhWq|wBt]$ه=-`>m_P}ѱ=RG2VPRrWv<%])Zc;T}WD"ʎu L< nz5뫂Ps'.>`qy˓sEXˠCEZ%(k t<gq; yuO k][,u_D35GΡ. hұ,ةāz!\y$fVFRI$WI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I.c1WV,?#urCI$I%3]I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$IbtcMgoRfec/$KI$)$I$IJI$I$RI$I$I$I%)$Ii[σ\տ;~W!IqMI$]NO2윌9DS')I$XI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$IJ߈\^o~F߈\^o~F52uyK"T!*I.uI$I%>I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$87##$իuzh[XUyO)@uJ!d4Su+a?%>dAi~Cc4k0OMe̬KĪZ=˔,u !ai?S=h'.VRGa*I .6^c&]dWpvsr j{Ժ8sUݩO UZX Z A<Ω< S SJk<'-y(@EZH4ɡ.)RIH8I!N[)Ɖ)LS(`]-%)$2[II$p P;)r4>iƚpL@)ҔK!0?$&I%03vSyL1I$TA$h8Rh)%8NZOp#DHOD#Ao ߹L{y!|S&SR65n )ҔВ `[Ki EST@ILvȔIO pIL$%-) F#2~I%(O~S@:&)JP%2hwM@̔I$8ML0Nɡ(I" s&SF$?dotFI÷')tRlp)HcNJII[i' M$I.RRSѪIrCCN0Z$) . vIY" Х\&O(0KBKHJS?(x)7]05LRJM`'ЂL4jRRHN Nl $IXВxI$bSO'-JI$EJ"y0הk)$ \M x4I4D%ޝ>NJbI$$D|yti)'L%,xM'&/dR#=I(NS$BS"d9J)I%*S4)x%^I%()Hq)LGT)TFR-GQ($JQh LGNH%E%*'D%0I$#JQ=uR HuI$EJDAO*CXI1JRALy)#%RM)$|xKO Bt$GI$R߂G_C$$h@Rp65 $ ":O)r]$ܤRIJDC8N%0Jb(J'_YHLIKAyLIJ d)$!45 p8 IӀ[lxBt*3E'I)N(;f44ʐa-JJS"H0@@xdIHdFD4M- L5NpUJkD)Xv!9n BiJR2dO[U<i<$iHDI$SJHWH r$iM)% S'iJe%-HRMr4 J#TKHۓCD~*I(Ra#'9> J=֜&N1/I@Idc%'IQmGWnSx. }Srj-}%:O@.y txSnsWC1D5 ICy%y.W{:;k|SEzs{vw;y\*"=oW:CU~eow}VNs~z\%<@Ke4za$K,}r@YK0}aFb^vƓ+=$ $I2tI$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$IuVFgloj38I$I)I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$M? k?6?/)$\I$)I$I$JRI$I$I$I$$I$I)I$KO|R嘴Ng.SiMOӋ?jI$BO2wr~)dd"9LI$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$JU}6Bz~#5t}6Bz~#5d|cYQUIsjI$I%>I$I$$I$I)I$I$JRI$JLh$+tNC. X]Xltubg.+:R;+Mh cE&DY`-ܬ\eGwVB"N IpX>MjJY'U}H.]x[BRG qiEڽGY cE ޝ;TtRuL Ή7iZ,"®p+^p2R@[2 %>hs\SkA*I(R%tHI$ҞRUr % :IdQ~ IV"b;&)$0'J. LN2<hS-9dp5HO [D(=pIBIZ 4)#"A$nФIBt=ӈ? $$4=S GtE2H)gH 841HHi)LRILa?:wNFSSܩʉ҈oAi&NSHIK|0H<' A"'l%)p:*X tJ%J5MMI$M)p2~ %-斥/JR$-'!ħ>i'->ԕlbyQ੦<*Py)0$Z:%̦$0RN0QTFM|B[NtZJdj*I%#;pP IiIB`%3 OR"@4ܜ)4síkшʤ@G}!>#%:Vb]CpK1OZD Q B pK Ij%? !Ӆ)4$Jt')!mÎ\y2)!7)4Ki'JSy DMp䋥E"RU,D p#$ h 4O%!d%,@Ld'甆䤛,蝣)S$JS IJ y) BJ[h ǒGT:INJ[RtH'HJZ8:REII'I%1: %hH^E83!$$S4RI'M)iAK L% GޞRIKײ[yDO$BD %]k)r rtNyI(I9L$LGt)HMR4R:)I$PqHĦIJA4j%(NدgBp<.? 5 [U R]* 9xv|a ߏW]%ܓ vB]NG*apThqt_CФzI opZ!oF̫V8m$A1:Sr{4sH&I0 $I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$IuVFgloj38I$I)I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$M? k?6?/)$\I$)I$I$JRI$I$I$I$$I$I)I$KO|R嘴Ng.SiMOӋ?jI$BO2wr~)dd"9LI$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$JU}6Bz~#5t}6Bz~#5d|cYQUIsjI$I%>I$JL,n5/e)$,C0I]C^7-j1RG;2bIK'1 ЬrWnhZVjo󄸭 QmG X_'UVGшX9UNC+72 `<"5J 2KjYNJyUvcWB#Z[5NXM'C+x*v\~ U<髧+,&2)ʐl7jrA׸M2{%JB0Q AUJxXے_Ctxe6NEkF=tQZ:D:Ρ>mJnRBuR%>.4JR()vlrSIHN E$$ (IQp#RiN] BRV<6#bx$ PRSH '6vSڥ%Um]*;J8 A)H ME}@%Ys %U5D3Eg!@I%ΠpeI-6ܭ O3BR4Oh a4% I61EA1iE<'JMM!OaN'2P$Gi?RI(JM)ӑ1MSjCb(KLjRA8lJ@Q))AH4"1R% )4ħ薉PI)mdJrO1i#TIX|0K@:JP><&ԩmd&$|R,)&NRS9L焣MR $na3sO)%0R{H RB`JI -?% IKw IxI2HZƪ  '4$4”&N꒘x ;bDą䧷XMYI4JRBZvNHI2t)TuQDI$ה)'TN*4L8IGII%-LvJԦ1D%)J*\ro)1A $I)~O)Bm~ %I$):% &S$IK4tMS)ALGILST4gBmGyH%)$ 'F'.$RvN $%2>i$5IR8LS$1 )1ADdSIR9n%K$ !nchR$LT5Ӻ` G!<'O JRRĤLi< NRRDGI$P<S(LRI2 \i)Ē} h%1()I9LIJf P;N$RR#$N)${')k mKiO8& @F94%KdRERBR8KjmHJxIm5'ӺZS81#HQ昦RJG*@!V%&_@pj-Ф*%[t?r1XFJa4pEkwSQSQSD!ʊpS!05C%7AO J.#M(qP٬Ϊ^SJP mIkyT bfyy jJjjg<5D\c⚧B%P3Tw+uf7xh]h!!Bv.Y};[ KM5#% ОS 't9"Nĭ yLh)<ܚ\4&> !rp)*ڣ КJ$(e< 0-6)}I85) i5RF@I%,Dx'):I$ȥ)Ȅ9L,` MLoI!@&|T9M:iH$Sa8O JG !c*@JIM)$:ӔI;TD)%,| %LIJ:NRt$J}Lt)iJR;<}$)JcI%`KRO)vLZ "SҔҒJc0KjSJ\$ xڤ!Je)M)SSxRO}RS<\$1IJx$K*\r^iU uSm7)%+sHtI)H>:I7dIKƩ}jn$ SwJG NE.RR $] 59g@ ILy /4tj)!<xLI!`':HIL JcƩp^i"JDiT#p&R>ijS'IKGtD4 5I4MJXxcDuOI!A7))hHNDBdܥ !k'.> JpR-K)Ɖj4S{  RLu/r4ZJDIJR`OvI(MΩRNt$#i)ILdG ƺ)D 9LXƁ9 H'RLJX1x/$$B!>ia"$'$I+&xKI:HyS)LrtܤDBNlM\$S)x(RS')mxK#0$B\۪i%.B imVo$GH8nʔ&pS,gó6,t:4]9-spcN%z2m󪋸W8yE,ڇ9J<16HOԺ-ʴ> 1Dxw3ŶzOI$wO<*SxiU[:; =QՍ+lWSzS5xL %6mjajKC'`saU,lМ醴@:|Ih[ŖC^<=XqӪ`Ǽ+0t:t7@=L1#H\2tP9$\]9%As΀.R~ɥ-IT."]Va, /I5z W0= ۫ K Vt(&7BΫ یn(r, LK7-jWvzgs]:gPp]݂%:>~ ,視--k sY!A&UGn-fY{QXr t߷7y<^NP%{">Y+zO>S`Я*6Λ{q #Σ,rĪi$$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%Y,~F*b'c1wQv9A8I($?Oܗ?r]I%'I\2TI($?Oܗ?rJbIA%?I~'W $J )O%?Oܒeة$PIO/I~.I$J~tzO$v*I$SK%p˱RI$?r^t+]I%'I\2TI($?Oܗ?rJbIA%?I~'W $J )O%?Oܒeة$PIO/I~.I$J~tzO$v*I$SK%p˱RI$?r^t+]I%cMgoC40*_sOD2#/$KI$$I$IJI$I$RI$I$I$I%)$Ii[σ\տ;~W!IqMI$]Rs'Cm+r|G/DS'!()O-),I<I>x;n/dJ dwKc JI<I>x;n/dJ dwKc JI<I>x;n/dJ dwKc JI<I>x;n/dJ dwKc JI<I>x;n/dJ dwKc JI<I>x;n/dJ dwKc JI<I>x;n/dJ dwKc JI<I>x;n/dJ dwKc JI<3׿[x1׿[#G̝<1bCIdP QUIsJI$I%>I$pr]UAea-z*J8SI_BQŵ@!)5n dto¸ٯk+UujjāOdqИ,$],yIuuNdàEtgЂ{@N=Pyw?0QXpvV  - eَ=Y cu/I$'K.9teeq0RKR3H±^eG eߕ冶Oe|7!Â@>Wo$Y5ܽEL>TwGpt]{mio 5}hG3T$>όXtC8Wcˎؠd86ݿׇuwmQkx1\$>:uQ-^w*}_u#oC _iat{HbՋǸpޯTM8 Wi>2=7xRFSAsH!jT<|Юo Hϟt#yHۨ0Ռ} xWx)ʁRt4*sFrpLdNxmB!Cr0u_LX)&{`Cڳa[DβIoqѣbmƉƥq7 1:*JgbcRoV=2<уWΩ`{y(T&p [{.zׅfB H֘֐-!6TM?4%ڄ  7!DpT(JRPsL[2| $.%OpP9P."RRRe.P]%&! e*U'%@NS*rГY\Wgx[cD SфB)Kr}!"(z(N0RjMYpKn{t%j`TO+ nSlJDҕJZ&fzB%Y4RQ*WTW5!\`VQpNS mrg≷yR5G E4B۔XY'JQM &O#Y=E.TI\H=" 4<$4% $#d]t FH&O4JJJsm079g J$\DsD@1*%"a%ZvQJ;LQO %))iTTI4QS@kL )RPuDӺo4I$6BxJqRK${I/ X}u ƩxHJIX7U ~I=I2yILc7M%0%Z'XRpHD'O)`SA9!NHhOJc̤tR!Gn!$RH~*@92$S[{vSЦ"Jj 4)L'ja)LIL e8'&JSd-ѢyO>)JiJRR<&-Bx82))xhLhE$$:%)v#$ )E$ IRQBqA$I)DI8I-RJe%, Ki%-5I/`!")򓸂@y%?p%/:d))O A!ʔ$)IL)T I$*cx=JSʌ'I !<ҔBb!- uNJ%%0?(<8”&I8$[J'&DB}ANnD4)mNr-y!4ƅ(2uMt)R> Ov7HB[Uv(^gFnNJnSpi5L<6}1tpJUjc Ф hTܥ A =KT-wPq/CTL\IJ4C{I0;$jJAAYiTbuQuo Å%8j bx8C+24Dˆb\)\BOPU獢eYwZ4tWy'ZO*3[wZ4R%q>*t~H!tHO)koJוҜ%GDPa1<fRa<*0,ܘTΊ'KFM Sp%#JA2x)%h (KME(IKh%=%dBSn5NRRRВphLR" R$$J as sp LuN)Ν# NJRRKN$)')KtCN)* .BA2I$$B\%@/4R2))@ɕ2 I)Q%)ׄL M @LS*`hȩmNRbTT$|'|Se4iA4)JJS*11VŎa>l;9j}^ &$YXw tӆv%tOvVEyÕձ>׏sD;竡pƴ63C,|7[/*18geњ<ק.,t* 9 " Ζ0rP"BV9I2HXnlB*I$+ԒI$I$$I$I)I$I$JRI$I$I$I$$KBK[ h{[ʗIEs9y?Ǔ`s|2eI$y?"IE?zs'O9ɩ$Z_;'Ry?"RKYdJ1w/5$KKq_;'VjI}?̟_|?&Ii<[KqI/g9y+ܿdԒI-/ǝ)<[Y%2%}; I%8oE/ǝ+5$O䯾srRI$wO-ȥ8oEf޳I$[eD8LkȀsuJ*j߆5xSڗ+[2P`|S JVcaҀ &!Wð( % )V;ȳIZ"Ttg-q*N* "pB4)f]ࢷZSH')#j UE~ zMB';p KRNg^ PۈDuNy `Hn !0I cBMV(&RUJTML*KUd֘Ԙ`Ve)CNʺڅaY )J7jCp,,Xuca*}r7%*FiCTQts[![dD%Ssʓ^Sz:>ԁJPR$5S P)J4&!zPdsTI*U%.&8O$BPU%.NI;mTRڔ!J?TwR0O0l$LmߢF;uM2ND&jbg>xL$ Q %j XQ7!9 ' JsP?$B 2_yH$V:$L)JAA RZ\ DiБ* JVk}H)Q+U;ޙM OiI+j:&yH8J4%"{0HuH7H rDELH ;$NR!? e2I()@  <)$ELZ"d#p5. $%49o)JIP$@)q))!@?$Gxx% $$$|ԇSrd"Rw)%&RI$RܔOD<$H  T)D "ւ O)(R耋Z'GT"hNEE(I$nHj %1RY'Mw':BbB(蜔)JEk#B{HTpT$)xEa?E0 ۓԹ1‰;jLJs\ڔˆ)8%'Rx74oQ L" J@XP-&U zXCڤ7\ & *c)sʓ"c2xI)(h<r^m'L*W<)O ҔS@O=!#A$I)FcD?D%)RМGt~jQ:d ILGtRÄ2A)4-$ODe$RMZ;#PS9AJu:ސhNQRҞgD stJALRR$$F@JI2ptM9NH"42I$(OܒQ) Rր"uL $%ShI$Mʂb|T"8)rn'J I:HtѤ'TTJE7))G˄R \ RNIKlBi Jd)h"SJI$|J!$ $* :%);a8 R'NGE I)`;$gO)I$R%s1$$I KR>i&:E%)#40$0NRK$SSN%IJ?L *% 4M ~) O RH)LА L J_124H$-)rx' vI$(ypH $ ]RH4KT HAJ"RH JH$&Jt)%)OtRmOtoʚQRɎq۲[B &?dr4 b TR&s{8M[)JBO'PЋ RURT Κ(mKjhIVrDhQژJ"ԕjTMmRTcm.5IV M)sd=:J@ ;{({KyZ$g QRR9LB}%8pRr$1-)D%#–ԠL%"EޔecJh)SUd xN%2)pN zuDh:PuF" u[#^: Ɗk[y]ԈL"e.S3I$X[%k5+,ME.JtE0FT%2r99L!%($*RŔֲ!sk R ) bл5U|FS0A= Gh\b4/9O@חP>N>X~jQK\%% Տ_*+oc&7N2n);0ܼ}/nrl66* L^`< <DŽD,gG28Z'~l!ص;R?'tI^ pXrjh!Yw߮Wj;zFZQeBBM)E`?W4B?\ X5n*~pQfq 4yTTv,Vq=]*)rs)rY^S[+]3w߸x[R̺,FQ^c !pOfvm3߬7CJ J? cJ/iM.RFgc (! (/Gx&5Y}`UuJRؖ҆ջƩH!:2{'Qڔp0sO]'.k$%jb_#DHו0J )KE,mp38$D JyIKMT}2&!(O)LATH{! I%J:=ЂK&S BTJLG $Je8KjD"j)aF)mpnO(A RLɟQT0JSR"ۨTy!%(B5q):Bv>% u~8;)a1r%Vj_rQgH)JI~R)r| nM2mg '8)=R yI!r{%JF+9 %a(la&RI2H%o⡣Q{Lk H)*yH I4J~M-zqL(򔤫`R8S5ԥp1NI6PMpD Oi3MyL(I[>F#$I$0הBI'%[<[ JIVn8x)s@xI.PR:0$R bG[:G)#䛔%))_GONDӷ)$I"RL< $R%$Fk$dJRE$Z| 㺖ӺA yNcA<$`ZO)!N;:~Dɔ(I'9'TGxR$k &26IѥZyD'l&$鑤ZLbT)' 1)lX JbyS{)ʒJ;$rE5 GDۓODwME$*MtR) ^Yhq:( D OG4]%=I<(&`(GrmJ W6\Ja>Jz7E)Ή B(@ݨRkcRa;?[2xR Sk H PsG *V`hTTT!mKΫ'+5d_Ճ:4@5;hmf\?RuNF *"Nݘ=[ =OVdh;G\]FqH@ ĝJDmq:[(Az^]u r'F+ R6JyM2h+lw* oyO۔PR H$&%>N\'(O)RR4ה BA:RMxHT [R-JDvL$RL Ω&$T!-GÄ$'IKLxR),L DcBS⟄A)$(~ҐH&D%8)Ʃ'RNRRQG}Ip) O)OA:@&$*SIH%:IjH[$%))DI9-t1K9N)NJZKT RpjN7 BJ^ & RHI) m{$I%)6:4$*Y-  |RI/4$'JSr)JХ%MA$rIJ:rq J\([)-t_RJ.|)vLJPT)0 %?$N_LSR(!PpS%O%Ʃr2t LII%*<B)NJXAIKh)JHZwR4FRˆ)JJc(R#(S%0Q){;R*dvMʔ)쒘BP $gS )OOop'$J[SO$)JHZ<KodB`e:J[LOD0GtRAKJhtRk75 H~>NTh.%hm/^>uvCMCs5&$]>96S̸Ze<`4=ԭ̬ޡq*fx' :{k{>> |FH?_#T>0T">+h\W*ϊ;/46~xJ\AQm*i$II$WubkuCOnOa wгTYcc|3(qG낕;Apwg+9UB{ ZLO#y^b+];ͩ"xLYX J Up/$I"ȤI$I%)$I$IJI$I$RI$I$Iv;?:,i$x+q?c)gJ<φ<""0~syqe0a54!h Uz]s3VZ7 7"O5Y{Lo/q߸>n;޲UfRVRKY{L1:Kp}-%[n'oE/ٸk1e$z/q߸>n;޲UfRVRKY{L1:Kp}-%[n'oE/ٸk1e$z/q߸>n;޲UfRVRKY{L1:Kp}-%[n'oE/ٸk1e$z/q߸>n;޲UfRVRKY{L1:Kp}-%[n'oE/ٸk1e$z/q߸>n;޲UfRVRKY{L1:Kp}-%[n'oE/ٸk1e$z/q߸>n;޲UfRVRKY{L1:Kp}-%[n'oE/ٸk1e$z/q߸>n;޲UfRVRKY{L1:Kp}-%[n'oE/ٸk1e$z/q߸>n;޲UfRVRKY{L1:Kp}-%[n'oE/ٸk1e$z/q߸>n;޲UfVGl:(k;,_?%HfH=Kc34r!0_&8u?n;޴0Mb"gEͭ|JI%RI$I$I$I%)$I$IJI$I$RI$@149;B$p֟տ;~X^hr LcovI.ٿWӯƧ1ID|7,.k($\-w'3i#xeGz+XT%7pcR1Q$߾f?xe/[?Џ筟GYw5/K1+Y{ x#/gwb_G_KnƭDnL^=/;1Kzi%7pcR1Q$_K=lB?R+Ie?uԿ:jI/f?xe/[?Џ筟GYw5/K1+Y{ x#/gwb_G_KnƭDnL^=/;1Kzi%7pcR1Q$_K=lB?R+Ie?uԿ:jI/f?xe/[?Џ筟GYw5/K1+Y{ x#/gwb_G_KnƭDnL^=/;1Kzi%7pcR1Q$_K=lB?R+Ie?uԿ:jI/f?xe/[?Џ筟GYw5/K1+Y{ x#/gwb_G_KnƭDnL^=/;1Kzi%7pcR1Q$_K=lB?R+Ie?uԿ:jI/f?xe/[?Џ筟GY/֗zu'5pjՙcZ:^g׿[Yd^\#,Gd99n)W|19V'\ʍ@oplWLK1M^$JII%>I$!f+r5ˡ($Dž6ISfH);Q'ABS `eJֲ΅s1<+*oYM)L*I'L)$Z]7|¡ϴ|ɘzDzDH8Ӆa %) jCnE[-H I`,3b˕cl$:hIs4tE)RIh‰Tg@SWICqKz]Op<R3Gxpi('ܫ; \9 1 BB UM'[8@|q\Xײ<%ʊwhS$ pQSSJ!2tiz=?49L0"]AVL)LAiBgW}GPY˞9d<=!3jwe:FZvƨuD$VP~Ũ<]T-w-DO_VF!%$W]bZA*h%t >Zfw+ÈkbZ l\,rn)=/6M$d: ';,n _4RZuմc)Pr9\bGsi魗l:C;b?VϷM}~Q8J  ϬUnhw'=gQ:{1џ\ \XumVjJi)mLXiSYX߷I:;_j)s`LX}UutuZ][@S3ZH*{ pzA4m3hk YhxDr*RVAG ĖmTο`^<Ն}cJމ@G zA1.n`Uƣ_ Szi%%ҖC:drΫYB*[ m-UE1fh L/1AJRRBԐ DIOPT,yjZ-q1$ro^(6-XPnTT[6ԡKJ xH*ๅ""UICfG!#i:u"Զo )#AaGU(Ojg2xDB&.ܔ$SO?rD :J\7R2PɅSU .: vnM)sJ/N~ c< <%)&m17% Z"`t D&<ɦSJq@V{L\( $a N-T#@*)e#SRxyL%$*"lT$J\tĈV28LG\'LH$"]t&AVdT:8)&O)Z3ZuS6I"$-jAAOS$hT*|%ƽR$lj$ƥ0 P5H5H"qP.JRփ("6Em>*HX%elɃQ87@xYC X /ʘ)[RFp?#DN%- A )K y$tM0R%-!x$&r.4K$4B~RM)IJJ%" :J[@'7t%1HI 8)O>DS@=;Ф`GtSײi!pMIQL@ITiOJp<ϊ&U0-NRR.O ?tmTl R)R"TSR )M%)(Z)@h BpcBKT?STf $L(8J-["SuF粛Bf褔(9ݓS(tOd 5>!:"ZQ)0JPXEs4?8rτH !qZq]fuy[̈́*]FE=&]+=O98%ۺqǀWW:FgA26p*Yq.w"t?%ukMmlɳ`˯^e8MQkDԮScIѾ t@֬Hpi?%6֞A~IrcYŘU'cܬp)Ԭ]7h\>hw?YIuRJ̼U`W{zyv79}J> ]&-MwTI%] RI$)IJI$07/FM^suN淈sL}Aƌl:YCEWX=҃Fo ','nedHi"BkIx庠N2k?Ir$餒I$I)I$I$JRI$I$I$I$$K)oV^Ei\濝?݇c|wuϤρYkS}&| I$UjI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$XZ70~KXORnO5-|J[#8ɤJYI$I$$I$I)I$I$JRI$I$I$Ng.YO|R?+?8IzK>)(菂/K>oe<ʄ*I$j$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$J}| >:߈^ww3ӭj?c?NlܧFKOc?ꚽyKOc?ꚽPI$rI%I%>I$mYŭ>iЗ R &NƴAⲪa VXNaOx'(b(ʸHvMc!O[ )}& j°5[i,''Y|ՕUZQL%$IJRSJA%)$Z=1+JVOM>x"ыƈPʔ꟞ 8*Ll<: Qw P,GTQ2Pr'v p3x )&NTI%*txBzp0du&NoN.$)&&i*RI*fd2AUyx%ՓI  ~pX4)s $IВI%I$JLC&B~3Si$[lSn@!FS'w)@J;$;e1`<8LS'AAyL cTO"€sPFA#u9%qAu29 >SG;?M"$RiԄF N ?7(2d[T; .ЬcG4=IpE[H$I ;XFAM-X<'ᝤҝRXaO(܃b S$>qǑAwNi%aP4zwfwOG),=v@]#5ht۽JxQ,xYj@_4X{8[Zq,5+%dT)Jrؘ&}'D%>"e㔝:B\ GgR/)z( #XarXph;H Kr\h9IoHs'Djkƀd;" A*ܗ~k|aW] Ï$ӛ>O;* !'܏AVHVk>91!Nh}\|J1Bp  AuklBϬoiM/oeN{ˌ}ʱ7UD M"P`[J޼ LV_qh̪Xe(8殳SYH+͛`:[< SjbRFpIirDNϩ.l%]BHƤӊAo{]LOrSZ TvQw5ڨ9(U8&-lw&I8L2Y%O-?Ta$L6(揁R.iRM S]tm#'@LBxJܔbIӹNmN5ގ('ɡ-Ҕ(*ajpGb[aNR(*$LJT8;LZSœ&km*y $j 9Nڕ*t(85QS)"q\<7D8O}B| mHQs {'R!0 R;a'91LJJBJ\x TBd& @-JtО*B[ iI8jxGQT%D bG yS'LR / N jI)H )`$JcD$+RLH H&RĀVQ 'i#D% )bRiSM  A2PRئԝv&<)(%K Rm O)HHT3 \% I$%%hHjR AMN\"JE 1d&GwF@et+;.ZV&F]&IPQ(̤R/JF1(o&Vѩ7y&]e1@go (#d5\u*mpVl_ cwMC+D@T2T"yl ; {LcY|˝+к%Ffx@:"Ti*LyX XmhT1!["UqOJu%>Z]`.S{CMcXVh&HZiӔ^i6$<)I D$ `SD'<%)(hh :sd))hN e0)KA%(:)% %$)R ~S$Q$ J甒O)RHORLe/s*Rp"CiB@Q PRJ!2r *RCDH씥IJI.R$<R쑄$J%6)IJ)[BIq~:KR:hꜤ%*%\Ғq$5IK]1NtJ _xNO $:D)% y$R4'4'(JOdT웺I@I(R焔S%P$Ä%\wH$'(I(H O )DBR7 NBJP))1O2JY:Z %2IQ)BpNu))JXhI':p0 O *X't9L,Q)I !@+UT`FjJcTXP90@Q)ju2`e;L6Nq[U.*Ә.Z-DW>Ihir8n\GhrXxEޔ까??0Xy[Vz}t%lvױ'qIC|Qfl`:v" if {<$7VDeRshvVChkR6Rry)dَCRƷ#㲰5UVez>+O7JJh.9SY/S%[> +*>+e48{:W1~)W_+`NL p{7>sq/?&s-$FGyˈ$:}Yb |/֛)(菂/K>oe<ʄ*I$j$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$J}| >:߈^ww3ӭj?c?NlܧFKOc?ꚽyKOc?ꚽPI$rI%I%>I$A 0IJI$ÔJP)r:`<“ms~PI!"6*RbSF*? C#'EHvr;;J}l!DU/a;\SO ʔGbZX[΋x8P55܅)CI R,ޝ֫O[q]B*=4:\];%wE;\\`l \,u?LW#`+0IH­BnenwKBCICH<,?g4{ʬIc BEM$NTI$d:0HI$ܬХ(2DuDdj;Lg %E;e,uJIjߡF z}qq8|q8: n$܅7?pq[Fl):6䃐w2x矅:hT,n#Į;uB0r}Mr4쫻tYxn_Ab}$(.kQ8iA]qa5' }-ȉ4 Gg[iB1dRM@9>XqkȱO/`0V><}ԢjR }TJ}%޻`:SēUwJ4P=3oTMH@[ O&I,o+~Ҙ4 =znB5}Q2Hp%3sr+Jڮz`4Å}gDKNZJ=XnlI N!(V &ÆK}nk]St\5Z謳O몯-Q)E0vÛ3+ *=~2)JPE MnVSzd8VYxg)$QnD'2H_)'SmALREDvgBꂝ$В*`Ao R>a:hI$S)p$'I%,O) #BB_$ВtS-hj4' JR+(fM JE"(P)Ja%> JrSBhC -BIm)rJq'E RLQC!O;~*Rɢ VƩΡ?T&('B#yR p% }*Xa;Z&JJAҞS 1`ۓp*AJ4,H6T !%Ը&ePJpp)HOENΧK ;'%4 pU㩊Wg05J~p]ײnѺVme{G Wy=NA9XY\yJaPH(&`6O[KgP:n>UbۄaHȦ\Te8BV0ˇ'\t&Sp @"5ZnN<ǒm9IHdkUWN?o `-U~b:nQtog+9:%3DUZR׉Ss5k"μ)!D(꫶ToX7h9V= rsy \HhtRbnA;NLD|1HBid4ކ">"iI5 NJRR 'I$D> JvHH P;|8`蜃-4)L&IV?mTK7TБlI%Z\%  ;! 2*H M:I\&~(e-~Ji@A\KȚIrY)AkmLS%GSTAK^I$j!.:$5NBotAKʔ&KHmSCR8Q$)D@Lt0  nJJPĄS> $Hn2]RMRLtϲIJZ>Щ(N RRILK{RhO &)o$xxKD|:Ω5NtJyQ RB`6MA)RR(K4rt) | JI)\sG^RtH pP 'D~KD$TK^F&O()b:h jI.)PHR$p()LvH$1!K@tO)JdRRjwOLBRZЂS 'DИIKDG))*P))BSH(_%,Jt<} -y$ rRKniGPO)IJL.R&p)H)JRc$BQPI4' I(H $r:I% h TMtJPM*<'J#.RH)&N Z4NRMKTy'쒕 'L9 Jp@L$NꟄ$GTI$I$$tHRb xH$BCTE$))A$:'SIRВs H=\$$4I$e-'撕ڟTڟ`$$& DRR*X6ڞe KNO )P^xH&4R:$ BPB\HɒJH^iB~RILa0 t#`mROI/UJtS8%*ISB$tKrD)8M)d8)$Rh$)N%悖-RfRHɓFIp &J%DHRE Q3H8L!(婡$) RJ;(1(-ZThO L)II !8 S&L6IF#hT(R:8)NxP&S"Ta0e;u0 @If),J~3KKA]fHcH>kf*O+JY.G0z^7PA{F׫"v? +]mnf?۸CeuM;l^ CW3E`3Vn5]b1~C[-A[ +;:c@hT[ G;}|C>J_JY egakhZ9/h䕟7VHoGN.D}Fr-sHA{ lU* Ul~Bx*t*;4ĔTqF]v> r?+wp}DMEOW-`C*g8LqళkާFI*jfI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$ΙEiU)oVk869qnG\L:gI%]I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I%#m,_?%|de/'WcRĬ?\I$5$I$JRI$I$I$I$$I$I)I$KO|R嘴Ng.SiMOӋ?jI$菂>)*4cWH_?$I&RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$ww3ӭ}| >:߈V?ɗIlt3לtt3I@)$_I%>I$$RI% &, I2tI%ߊeBxtr~)!}7M9X8Lc.xeDk%cD~e\.u G:UmahU?VW$LKjڬGd\ct Qڡ–+GMu"Xԅl>i 8@)m7/B@R-%H$FuݪI_ѡNioȢnKz%4vWqt-VmƈoC *'xEn=LzL0"N6WO T3tŢTR nNMy1ǎXmLb5T8*?6;FY؏q!G$Sܟr)J\EuIPN8sDN)"'48uA.'ĨY]e-'ۺs!Y]9i7a5Q'РKrQІmnUYn~XT2?RG^՞J_npG;IBC(J_g~%{E~Xup5\>a@}fsgKbоtQ\/=w;?4|#XЪ{Rz?p} t*p?]`!UJОZ/;W켗\IU>JV7lGKy*Zi\0yUf]!HTE鷧=t2~9FeR\41(t :X&hH!&܏r 6\R'"jhDCrmɇ"-ïwVZg#OsNSJn0VVMmP:8QpkDMʥx' RhSF{lNn3ʃ{J@)-4-m8xH{k"$ (( dqR's=,<%e$Or8BIC/V 1IdkLB;ʓҘjUUSLOZq/d2DUY\+:.lH:fh!l uN1%O$RBȍN>Q6< GAǺ<]ԋn\?ɞ rПrpee1mM%DVG?zEP (e;Nw؄u*1*<)!'4P~ïzxT̷nA9 <&қ.Q$r8vC !< oܢb>iH"4vR-3HLI h<$ )%)R*a$БI()ܕBtɉJPR:' @%BdTN hI"JH*:hQ6* d%[ j%% 9M)&N [<) >KmRI%q1)'QڔBdĥ PRTv& i W)"P%%Kj}WБ<M 1Dj !F%2%Zx$K"e#mhRDQE?tph}Jt RM*D_:I) )ch/Z0|SBnS꒘$ m!-xH XxRL(W7xJjNPJ$ROHI H I$", T22Jp"4b"IKRI$ITHhtI4E-O )EKrK)H)5I2}$Q 'JƉ)HX) OJH\.4N(W:2GKRU$/Irq()I$)I2JZ<I'M(IKFI9)1HxM)R>?G2iRi SNmRGd$x)IKwK% ǂZ$r>) JMpe)ǔE(dKTɓ%.MG?J4IJ&JC)G)'$uOJ[G0QڐO S)4EE9I2 ]0IСRqa)1lZ(ִjm =WN4<>SѠUeczV`3l[Ua\rQxPU[Ó'l3d @]E#°,$e lw(%mtz=:YyyN8F麒PONFDJ9lTƠR)%BBn֎Qagsi䰾KٞR;/4hAVKCKRΨUXhO҆ GhDqM,>);PlVBՏGWRkIɻ:5Mb\7Wmb\>Q|ʳ -dozثF̸MF}I*(dI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$ΙEiU)oVk869qnG\L:gI%]I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I%#m,_?%|de/'WcRĬ?\I$5$I$JRI$I$I$I$$I$I)I$KO|R嘴Ng.SiMOӋ?jI$菂>)*4cWH_?$I&RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$ww3ӭ}| >:߈V?ɗIlt3לtt3I@)$_I%>I$I$$KV5)!♨"ҹ`2tɓI&Z]0YЯZ? 5T5F'!3T#:&HBjD S' PXxW;1Yb?1PAe.S$ BI$(E*I$ZK/j]7"oYz.A!t +RdEܧvl*+ G"‚gV\Hο**i$ ԩ$NNI+,k`V]4Ү|Pb},\qNPӇ敡 ג(/ܠeB~--)*f3p{rT5]qvYy4pJ7moP*U}T- Lq`ޤxQW$6ޘZiQLw cL96¡Ԇw.x5U nzQ$j*r$ZRW tI:d$$Jth[ X4x sG$vX 2O '0 PT &SBZSGTK.VR EԨT:z| [㾮8H]fed;(ozB󼷺I^P˩H.=V*.RkL,L ,aV[u[_Xݎ`rcV;V깡A+jJ,Q{oCҳ'c\r~* &pauf?Aۺ; l~i2tЫɱG+;e1P+}4pLԬlIU!:1Gӄ 8zbJc`S@īx O*{SlFG tG`Tiy=k@Qܟr[SmBV>ɍCf5 RPR7V4E ANRj(!1hR)M)$H*Bnʛ^$x)ԨqhN4KpI {!#S % Ԕn=!H;T& P1BF"d {BtRG 4 x#U3A!IɡwτG0xP@*E݁Kr[ɦԧT &[}[t LZ[JxIjwAeZR_Q/Q/t+/z;PR=%Ð٭=Ht @ רo(^x_~q.k8!;z}gM^^/wçVxg ߪ*r^?O1E6W 6;`!XnתՅWz[p3zJ_]c`gLmU&/_3y!u#@+cbې98u V܂3GޖP:rb-n@W1HpQj ^ܠqiA zU(v)H$*A%p@B)>*6N,b1Gܳ۠1dj~I ڟpjF/ |KyTlo?;oԀ4A>CP2TBm iу7Ue~ؔ_kf8 nD fF[Ϋ< Gx;B֟xH N%ZYMwBtZ5yk6%|*.arnf]g٩V:C'FUw\ gܓO(dJDNGRM,䭦Hr* R&"PL֗~?pÄ 1ΨATfS U"8B"QQsJRR&5IjJ[`SҔ 'q!lnoDB~JP $Ge0{L-S$ԄS IKqCD,-.<',g ꜉LR;yRsh{'9 !(HREݤC!>dИ&!;%w>I:ƩCS-Op)zl`!0t*H8Jp#TgF(vxUDc ]eBΧDzQ("&R[}ڤ %}h#QT!0p Di8)0'pG%fM)D' )}n:R!1:$Sx2 S JcR)aH{)$)hJ%N'FI(l#) $ Rm(*EAI6ԉO)*HS LO)1Ӕ"MtıOx :vC?T(I%o]k6XeF0àl -`JdI@$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I.D-ZUzgJstvN _G>>eN+-$IWi$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$Ibk,[K_Fb?Ka?XԷGq+otW&I*fI$I$I$I$$I$I)I$I$JRI$9Թf-?әwKCgtkI%,#ढϢ> Jc/i*.WI$ITI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I(]+~#5zeAϯN?#Uh9ery=/]?ju/]?juA$P9I$I%>I$I$$KKϮ& jsy }]x[{AЭ <͌LKQn![OĬj unׄ74v S$|SpYJL:韺TqlsdMҨgNN$PۓS [  $HIHpI,SBZ~ +uExA/gi`;xB)'M - I' I+}<֨d`kt_76Yh JR"RBI&:!;D(+)`+G*K+$eODCIBJ$$NR$JNv+ʇMԕ|tbы);RJf ږI"g2yQ$v@A$ޢ=ꢻt!R\2+,½\)ֈ$P)I$I$$V0uj!d8cp;4CCu-=݆vVyNa-ܠT]ƪhV)%_^HyKPd07\8W^4XvyT9 k A.k'PYYʭJR#Zbp$*{) ?%NX( vpv%QpZtD*|>pCP˴&Q.iQmg$%l]✽TO7GCR1˥6*9jO 䶦5 h6L*rx:x;襹 Ta$"[Bdk%<$RV7R.?p/L)BP pʈISL R, fO))I4j[oO J NE"CEH)JRQ()PFҐ-jB~J4J-:$JbACHLڤҞ!kt(gA(RЦA})D@ -W{ YnچS}H% I$TlHZ54 o1%H58d=._Ȣ0, bF4T̎4 Ojw+k}V@એ<'R O$F6dx*X5e)eH5bZ Hu|B‹vSKrAI%)Z )D:J`9GD.$Sxh Q)Bh۪VO1{#Dh D'l԰ S/x=䒋y)4PDc%9hB)8Ji n 2~AHH u RRd(nMBH "SJL{&JQMx)hJAV)$aP =$LOI2@SD&8Ou(( @%[ R(N|PJRUZBhKqtKTr y%6TuH'LL4JXJ@MƉJ X'II%S(RM Ҕ>)I$RKt$$( HpRR LyJR)IKH‘L'$1 Ӧ>)mS .y% )I%)BR@ &RH$`$*RRH(tJ)tѪI_)IJЦ:P. SRR.u)Ή'䌦IK~ ) )^I$R7 䤦$$&BILuI(NHҞQJcmMIX'M:P8I%-)pN> LO4B@RLRR$4KTȒR $SGޢSR"S} Kw})\$BPd%))(I7%)JSRB@' OyNuI1#j򄀄)R4$Ωm<' 9tghSIBN$&&4JI$CTRe/4Q!g8OIpiQs$HK8΁ 59)'f(Vj'B6Y1Ljdu^Vf_鰮/W:EM{.[?*/h[miZcboBpqI9\"8]sّfw1 }>Lq],v'D~ke i`c(X%euk Ju`G4⎶NVGl?K )o>+gOMY`MPdK!A:D%+7S<#n}}:;jrbWnq6@NJL VKbm' 2 Ӭ.}j>FøSQqNy;E33{P>FZF#︑¾EU䣆`ܣݣO_Ňtu6XЄ\)Yl ܕiK69nN:I$ TI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$ΙEiU)oVk869qnG\L:gI%]I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I%#m,_?%|de/'WcRĬ?\I$5$I$JRI$I$I$I$$I$I)I$KO|R嘴Ng.SiMOӋ?jI$菂>)*4cWH_?$I&RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$ww3ӭ}| >:߈V?ɗIlt3לtt3I@)$_I%>I$I$$Kc-^t\Fy]<!"a Wd1tD*Yب|D~z*)٣\^ (W<$FjT'INTJh9;cZKGU>{Fjɬ+8c.vUB"(Q"%LIA4*;Vo@SGdR SIk;*;$pIqOV1`[ Yc瀭6arȡ=H*2S6; HN'b hL d RR$wR-C*!U!$'P)I$P:dI]Y};镧N@6 ]ŠL9O%GI%.Т@R$JQog>=͇QSBPJI$(I$$E? hXL-[ ?>lbQ RO1[Jmd4R)N4:b%: Y$Ibd}3[%cQ9n#xF$:C$I$ &N %Xp |-- )|ԙ'LGӉ1ƭX9Iէ|rnY@-a+ XzRwp]DzDBA(B4N-pHʓB nēINSpRޑpNEhXt(!ukcNJ鸭.*4!oBӪu]aF|Vbvz~,qVѠZGyP-*P2QHNaUR)FMTte&TKHi(D-FfACB8Quҙ-LXGtfgXmzÌN0w9wDc WuޤI:2HDE0`V}Xc }8=+fo+s'|)o.OK,z=w(Ѣ({fU>ߦa%L=.[,wNz'{VZgpIJ} C@vN΀>Ө))O -QMӕݻXRF)'CTyKD%jFH ЈO Bd+R=ũœO!KcJxM)h%[6H"ԥ)KD.\HXK&e )HJs5)lrNBtJG\NDЕ)!$)(S@ "ba@Y 9-H1KĔ^ABE*}m%(B"A ^rKtJ`8! Nt Q8 R!1Tcjwd4hr'of4O%(Б{*:ǟ{Ǝm;2РZrRQZKd%Kl $(zPH:S,BD(˻!Rlʘ 䩍1D8ƩL* @PtRD$\ pݽ-KDB x{"%JZΤLr57jTI!U:w@9:JRb@x0rbD rcl۔֍ިf!HU^YNJ n'刈{/Oks?xemTEZ? 3k:PyR L*.%lkFB}$"PtD*aНݪyCMuIktMHzv9 S$B`z~(Y@N8NR)J6Zt _P)J)JYP5H4WeA)Jm6Y&?1quMnLTÔ!R'ȳ;ERΞd񧊋vER)JuO[ղT=\q+}Ԇ*rޒmOdp/Dvuu;0NOMaЍzIJbp@QJoF@B5ޚ8z}n=nԸ"A-C~%> Ķ+2҇ }W,qЮfC$UU6{{*Bsf'DsW߂zRM ߢz)E}e5I״WRމ9DjP >M=0Szeij9?>Ҭ7KG@)"Q^NFr$DOtvc!BhE5Ņ7-ݬń@ϳ![<8Jť6)5&VkzhˬP )6 4SJ$McJvGuPZ9%-NTRO B(ԀVm &JPI(6,IQ|(I9U!i6>I(Fʩ? M 򜽾)pgkOKc$\R#Ċd ÁDԺi;ELx9yQR;R.aü۽9𐊒nGy6MiL&)0r}Ѕ)@4"R@ tNTv!JRfL KtjJ{uJxJ>)ӑ L2`H0oj&**$ƨwqraDhAV:)1z`e-SG)O*$pHEJ%DpħsCml)sQ $cmò Rc*cTiw'IVOjd2tlu4#DJ_JEòdlSS ByI[rhHLBHҭdJShJjI2q:"%(I6 IJR<kBP┦tkBtJ{$|HxO )RI/BJ~&ڒSr$PJyJcIJ X$IKp4QRPyJ <[a"ԔOSE ;&$(I:S 1$)Gt%87d$BbSI2D$I_׺bγW0O}b~ƞO sMhry*,lo N[qi67x-}ݐ/@ J*|l;lh/9:{l*8oʻӷV d*C2l*oqSК3"62lB+ү{q[l`` }?zh^t ,{י+j5 /sGV~ILWr jV tQ\ RJT0tB / +UM74ͥs^SR^k0)ƺv -!Ȭ`b-.XW/D_I5HGBXoc.xdlI$I$$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$Iw3%?mҫ?Sȭ+plsϟ8܎+-juϤρYi$JMI$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$K_FbXZ70~K6_ O ƥ?X+{G4ITk7RI$I$I$I%)$I$IJI$I$RI$տ;1i[σ\<\ԒI/Ig%}RU6i|LcPrBI$MZI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$IB^g׿[.}{uGGI͓/gSW8gSW $RI$I%>I$I$$KC2];OetmjaDv,6Y xAR5MNF#Zk sU_/VSK'$ߦo R:˭l$INA%)$Ij`Ѭťӌ<֟HuR^!4)&Ri%)vQT0J铡daXm%,GW=1YAXأ!H^J lJM:JslY\9TSGSlvŊi+}Ѫ ưvKŁkr`G7RDlͦT"n[[uSOd|(:K2~nWó KxR$%-WūfGi %8<KLvl!Y$̚)n2F[SabDRQ< RI$gb+[7|~ʛP[eIJI$'%)$D酴âĬm$>}+e Kq\DŽ&J'-RR2t9cVFx!Y?9nQ#%EUN$Б$N&!I$8Gp l_=5ItDž+j 8~ gnhk#֌0. v\8 1tn.o)p[ʶًTP\*L#DUʅ7: *lxU-NiH+Ԁ!ٞG'T'hc 0t&74qӨhùLl$ʐyNdӗ_L5 ]R -Rj OeT\KN4UE QH9`*>OdSP;'M%b2{{qqU^n압% W8pRoT Uݵ9E?DjħUKjTHuV!<f)JxUP鑤(IIa4&t[E-TmM)'fSU)ODkN8GL(VeH9jZY Br]A(Bx[TK[me!q m@A/7gG 6. [ʔf吰 c,Kppf*VP5n~wd3Dx9+@PY&ueJ[a ' (ln=D5 C-Ϊ '=S\"uGS=DIy*9 hK SG ӳ$ ߔfAcd0\5X_Y VxNt*|µZG}0ecg5A֮4 Yf2 (pLG5A%Ô9^#anGV uT2:<"U V޳@T>ٻWT>*hie9m7}-;ok_ D*iiTWm!S^H3-"ʴoߠCqaC>iE'UcͯeD&$d )n= tL aV1#3▟)}Sc !_uqyOιgK!zeY2 :vaPu `Q4 a <B!6"d%Whzpim-E4P2PB C8 N lKDe '02XR=vLuO0rP@8~}Nr}.L /;`>Jc]T%BS)q[P&8I´[?:9D-&%86A&HLqdIrX))$&'"]!Dc:`*)BKt#ƞ' - 4[ޘ7iJP$Op(;XtdA 翊4-A\OMRUdzηx+5}bΨM"b[tƄƂ,OmPWfvQӏ -n*Bha'}an\iS;y*V% @wg#2 *w*B9 *+cPM8UYk=EI^t32y%{UMZBoA0!o_Ef`:DL(V+&JԖeۓO܊jz~C]3Op Sze4[^ԓ [(5P(D؛j%.&[՚LhuBB!jh@G %u^k{Q{(% [RT.R.$8x"z5Fm p%HN,rׅ/VxQکJxHԩn "I=IGw}%6$I1KKrEnI5) {$8H=?B% :G)pO! 06ZUIO(r a DvKIw'{"hTD؄h(v,&-H4ͮD ;^PCa"HNyH8iDwNTN5HM)ʈ*)RL|RLH'T $RN4LyLL *ؐ ңQ P<*-AD @S4)$ĄE"GҘ*)xNa$ڧIVNR JJ$hIN\" IV0O2I )JJ)BА )$R!4B`N IQ%HŲHMH',) ?E -p%HJ:~Sk Lu0>k a)O$IBhKIR 'LSIK'J%!d\$PxI)%rqJ$HRMI2uBJ[eID'O(q,tLHq- ' &xOr~IABP Œ[Z  !I1P."mm xO07꘿T ZIo2BK$I nmjjRt(nM 'RTI)Z7R@ Tg@e(N'E&6Qľe AݣU*حV إ},|DDnpqvC!y־*%g}t|לeԸT:xW0-{]Vsmneªks ކ1"#`〈GKwT%2ez񪶰Cv%gt|7z$V2Ysdkx[ l6uCla㉽81m⎖RW8 %n`Rjn'XοVϵnhUr*Op+OӄWόc,2Rĭ *=S<{}68)#̂veUCE :I͒ ;[~j3U\MmK!!A7H v}~Q!,Kˊn%*s@iQ0d?E2\( UjkaIrJY:~*l'=T>VJg*xZͅ,#Qс>wEhaӗN=QHR=.۫.X =e%I$BI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$y?Sȭ*3%?mҹ:'?/#I֧\LI$ԒI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$~Do`-#Olp,j[#8Gq+I$Fu$I$IJI$I$RI$I$I$I%)$Ii[σ\տ;~W!IqMI$}RQg%^_1f|4y? +XT$I$ժI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$.}{u2^g׿[2Ox<.5z:.5z:I($KI%>I$I$$JNv܆|W\b.~}2enSk!)I:GNP2GAVk_[- w ;e'rV6I$I'I2A =_麒ÿ %)TH]" &)Ԋy0N ķ%H/\Of. "4ҤVRI$R2JRI$hbam0>lHe ܧ:դ$(r? +9 GuP8"Smo*)4#tFuUSG%-&,RI]8ݑ³_ e+\p! ʖed:Bnm1AeݗڞrRZaƊm$Ir[o!mӫG[J%y`G &~Ls~H4(Bw*^lfi,%SabZBGS} :)tjY}Gϊ6?}D衢cM$BTI)N `$I-,oa{S1dDŽtX[#zwV#|V5$pփIB78{/A7ີcj JUAonD4 vS5s)zƦ`V%criSFSĥ=9 1Q0c're&tOdf[ ZWC0lY|k>W-|_8y`vV/2fW+gBVM<1>v}B7 (轧Ʈ00.J( ?E?a<_CY<);4vrs8wE-_j>)3V4%EIh}l7Psx.*P?GL.Ь$ޤƉ'.H PQHL.~Ѩ)9:/:-;+pm w>(Ol&CPwTdHt7~ُN+DKB9gG^jH\>z=h7@Aw]Kr }"tu!j&YQ9Jh"Yc5DAvZLX㤽TV2uNCBY_jQ9eOc!=Z*Yn:4h:GOer޹%MB1eFSUUk/ʸ{WJ΄(ѨZjM;kTv'S$:y#%uo6`jPkxZ$4B*9`Mq 8V}n.+fX$>RCۈ+x@i`[]:e@a6Sꐞ&(a 5-!K/2JD :Р%B$c6u_ },A.Z.O>):H??6ʴn$Bv:WhSL d&$nnjY<,_]!UffkqcsDaOCu F19n RE O(ڭiG1`옴 7'܈!(I<vB'JK  œL[5Q Ɖ'B: g4Kbu1 S hfҍ!4SD;L!- *fc ^KN @I*RB5C߬w [1<:5QJ(CITC%t:&I:`)S (' aeAÅVcS8w H=2d #d\00Gud#D=oP*A0HW"'Df:TR.RI[Zd ðDqb} n饺 Т~oxJABOknoR֔ޓT7'ܖ\@6_ a贎=<5NiM [އ U-z0G XЪOni*&x@W ]zaZ%gMW4~pV5aV& lyDW+:\3hС.V%(aVt}QNyx2~Kͪ7[$+bp*ԡ[M%}M:7/X;kV䏚 *g=@4 JoAka(Y?ڌޯQQ yLx[ʪSbUͩUv:]eW&x-Ѣh !0ft'*Smۜ$AB;1)XOAmLXs` ))#VNE$?MTN0),aCjbP"탱E%ܜ9W̄{d8R5@6\/Bs`Pږ()D{%CsyKp(mMSBI7nD$$)bE%{NL od"1;E5aj I$ "T-Q(Cܤ PS% ҕ М:S$J"6`R(s "QwmRR&qQH6SjԳZ JvO)R̦IB@$΄$NS&h%JIKsҞS$BIQ $S NnSE(N-@H IVd%M)9)(RIVĵ6-RP&6c GJxDnUP)|%PKN%@tUI%9Q.L ' NrQsB!Ru?Q7T4!1L)(N&BlDdKi)ze4XRIh0;YBp2RI6MB#X9Qiݩ?)Ɖ.ݵ@SA IS)IGeher)!R lL#6034XM [N;׉qcNINа:P.xu~1ٵH^$krx=~cl`k c_D2Օsn|۩+ o {bFi2B!c_o3}GU݄l6L;Px*={-䨶jn13ʁ̖GĕEiW_tpBh* jvRD|PoSꝓt*Ng^h}bkRg 7pS2𪹥yzV 2g)dWyPt%Wj4U Y(O0ž]Gp'ii KPsM͈Fc t1* }U+*6浨үy!gN[@3aVB5yKkl=oӬ*uJ\q#ꔀ-3Y$p aVm8 Ȯǫq\rρDCD*tjBI$-RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$:gJWD-ZW9Oa?qs3VZII$vI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$/ֿŴ~Do`)m_K{GVH>%ri$nI$I)I$I$JRI$I$I$I$$I-?әwKb9ԹO??6y?N/$^Ϣ> J,#फ>l_?"<ʄI$I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$AϯN?#W]+~#5Z&_)o'G^qGTI%II%>I$I$$JUx>kvְZ`8NIc7RZ J:!IRV Q*KiuǷi>*I|FS=Z(\ a4&%EiQ]#T?GE3i!t VdJJs!?P˖ $QHzp!Uuno!X9kdgpAH%ҮFrQNI@ 'G呙c|T|[p#8@H%),d2I$)$I)3QV? kGIH)tMH[ RhI$ĤJrИ%.)O(9"XV9[6~  &?\XwN<"I$JJI%&hBڮXAHeAȻRӂtV2d'pI$?Up叓KX!eH=úK" BtCEnug%-(SI^gRxU"Úw !PZ]3җ5/o)@fb k_[U'k + ŀ&qB-Qu`eB}  6tNQRQgGuY\as#rP,(H<ʲ¦3'F!>PE!8*vV- ݖxq ͤp*nイQ%^;3cPd8)*(9 ۓ`LX8RnZ#s'V {T] p`Jԝ"ܐt*^K ;Ix(H )J}IS>A :%J`XZǔOP5I1sH)Z%Tj%JOl+JwmLܲI(*U5rNj瀯7%H吨A8B9`Cei*A-B33S :V 8r_Ёh@CpZl)ےʠ, AٳC' U@鬸hpԭC9MŐy*MK/ijfRT|To 4PlVlqBt\k#laje,!ƲyIJ v|~vcx Gt$n:jt+8,'P:hLBp o8WҜ'U 6)[Lq!YvAC.pZS^=Vf%h`1]`Qqjs`諸"&k|QZPou(̩ PUKkZ62sirv:"W"O(` Nb#AN'AUns*Yn;,˯}P.Ǐ K2UM^SչScd1VoiGDhΖ!趵TfUEUIrœ켦< >u w6Kػ? mi>kuϚ-vE +A*ag 3+]T$6ϟ!!}oh,w(֫#a#hϕ@ ;.<C5Ҿ/Zxs*6M!H% T'*?Ru H*9LmP͟zrA甥)H3;(iLHyJR(Jʗ5}Rky-%jQy7(L@)8'|a`!1JI%j\:5!79G BFRKh!8-hrr%1se-ɥ)F몗T1WiO' "R bR JTh1ʋI#^SKl&Rt=L|SstMDF{")LfuIW:{&ia"H*a"FhI<(tS) {r@RJJZ$9O=d2QI8Gu[YzrhyD%E͓iJRI65IAdHKr}ɡ$uM44A#)'*)%eVc5B Ei3=vnLFR@|@(HR 3rHL:(Ѻm -Rr+v#Pp춽>O!nKrw'vd@`qZOo5aSӄ­Dc+}ei ) =8rw)#DgiD-jA~sNSB)!I! sL V' ,,>da:7Ǵ)dߴ׽'֝CH\6$.AsSNcZ7r4JvJ@7 g?FI=~ ^8(-ꔗm%^h ( rw bYa9M)Ŭ ԶNPe7'Otҧ Ÿ!+ڡ 'iRҔj % (lT[?cQ rA H X =hp*5%- =ҡJeiCjEpo{B%C @eL 1LStJ~CvT N pDPȔҔ(P4"  cJg)L(DBFVq*rpP<)ڐƪI)Jr"! nBʎQ֐S TCʓ)jj&*ܗ(;D'>N'u2)BfT QNJ'd3:b@71!E) 2S (pM%*I)M 59MUmn Gu1["P6x(੒SAW Mc! wMI<5ҫJmX jE>q.2H"!ӲpAKl"IBHW- P]$'n:d򅋥Q]$RR/tvTP2&jTKe4mTI/$ᤤ1THVZM]jLj;b24yYٍLggy\G/MXIJEM.*d\[^W[o4/e XiD. 3-K~PE v&U屨3Ilɷ=FXkZëc @Rahm~ivTfgJe/RKǚpg k]'k fy^>&#B68a[N1-@u+''K ƅQpUJJ…(CKI*=O<{}6d#]=6pvsdKŏ$,U$yZRr_%oDov}$VLeF6IW[W=x G"g(YVZ;|n?EK:6v_$I$I$$IZ> %jf@)$R)(%I$RE$ I$dWZ´]f qTʄ-53%H$Zӡ km BڣF %Y=RURI*sћԌ{R+ 02,gYDz ,u$|*;RG⹽ $r)<% x)ÁOȄ2¢[[`LkNRVB*IR)ހFIh*R ;y p6aOtޔpUXH{SV62גm)bR-9R$*K))T=ܩjFҒZ)mKj3Z\R6$ BԶhzm%G%$}J²mq-UKzJa%N`XRS |(V~)ÈILSĎ5SILM%ehRB))T%DQe`ZiF M"7J&al "ƒZaR8BpGNNtpҊ8Pka9-!sGUw*ծW7YLSg:enq\tQȁVq6{yRn,X}q@1Sl`Ybn p:, ]h+:N*x=Y J:~ʼ4A.ce`2[V2ǵΉCi3+`"f{ʦI갖yY6K rĝ\" FvT-oA]0քͨ':ʤt[YXD4jyUR}iEeJ/.5х -|a2#x`]d."V]2TQtvc%&9u @A; ;']VIK4* jw3m{TdZUL>T8BZ({ZhYC"d ;IeE<MXB[u \vf<{iB8mlUNKkˑGN(`@: 64V!LdL;wާI#k )ŗ4s  ~*#L1F}[oPtRSߎnS&uo0$-M8gq#TփfgixS9$^А{  9GGţOyK~s+>e7BqX<&5{->(EzeV3pl4+]nUC)2g P, Eg bcx8J6iJ]\'ޭg D=F7GKU-(Hprg7 ʞ$R4%eݑd*2Zd|Td<%کH5W7h"e4QIv!I5 JI(J5(>O)Jԧ{ pgd+S;'kx2Nʋ sR. 5 lvllSXUS`#ڲ~>kj]7J|.b\l ?nvN%흮[1;r4:aGDkNInSѫ0u +UF T%NI.2:I$E$TI8 &NRI$黥)rTI+X^aci`[2>裿JUM) M!#+Ms(M<%}HH.1 IKHHe-RODЛԁԋT; 0թة`R &Ro+éP+O`$ILX/TE@M ӣ27Se􊬝+(1QYWկh*άDH$Bn'U7q``6Ɩ+i-wux|xVyH eGZ糢v#[w+vgTkvo;@Tɕ~b=qni]\ uD9,y4 '±s5#v0Nz[(t[π#U ?ю_ FJn' DHG6t+wV}$VEɸN`>ذK=Ep%HV0WXz r+r?4oB:C|68/I^C^4RBgo!z(RkNJph!|c Ms@NH셑}0.̸*B¸^om)uI1YFڶDwL@Qf; (bKu[<^߬߻,Rvxb-pj t7[ux7Y&9Fry2NgqZƥ}C-{OLQ~ ';BЬj}P $SM&Ω'Lwx12BJI$!2S4,I$ܔVJ#*(]2R0F(̨wDmjQbAѢP$Rԙ\=6rM5XGH%duo =z_=ZtkDZ4hk]pK+JgWc*`Gdu"2:]$]@va{}^ȸ9ԀNԆ5f9+gyTgS~SLw4#xiЫƃv1ހ0jىm!h;SY3CGe[0*R{b*R uwc{lBcM4૽/?CikCDo+E@|%d+S,u&ʀTbhtV}LVL`ך_2D;9V} Եx +S\ VL4 f*3;8Vp~PnO,<֏܊8AFiha:DD*߾(u#/K,|#G] !DmaDxR_洱Z'Eȉ9V-sg`]EZ|VN'9Lϋ`ԍ{ReøUƲ\ILj?Gɴ 2Q}a1~!rɦ(\;LGW+I$J$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I.D-ZUzgJstvN _G>>eN+-$IWi$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$Ibk,[K_Fb?Ka?XԷGq+otW&I*fI$I$I$I$$I$I)I$I$JRI$9Թf-?әwKCgtkI%,#ढϢ> Jc/i*.WI$ITI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I(]+~#5zeAϯN?#Uh9ery=/]?ju/]?juA$P9I$I%>I$I$$I-<]jjZxz) I$ȉ%tID)$Z<[SXcxb)BRs8L|!@BIl*ϚHS^KgIH$S'!2&I$dI2O!Q*N|.Qrg-.ИBp  ^:iI3Kh*D&"J 4y 9&F`!Xь?cNq1 JޢG4 12<KVWآXQ[#.L\h>8V#IAWE-QR[b=8㺳ۛܨ\􀀣h8JbaRI^wNPOx(%fpI(oO*p[C5vPJ*$JR T-NkGtQr@K`TLS'QjE,9IHGV ;r_?Y=TGuE.RH$t$$IT\ޮr?t7RRQ Yr>􁔗H$RKJƉ)I&JTJ੕eǂNN, nH#vf|4b;AX86?[#A^yx|{mX! ?̅~* {!h)'޳O!9cʯ )Ԥ$E* 8/T;pB^\At)z[RjhUB)mw )J:*R.S4.$2LryP8)ڒI$ʖ!))d:H) S%I(NST%J$&ڦ۔t!B&і,D_VpG@Q6բ-N/3H\RmM#Yڛj.V啖/K@&ڇXM:,Mk/+^!Ldh` mɷUnolQ5-rM5bcYSnNpvUfMRhm*}/`BfB:G5n}6OX~\b@wNo #*iZ΄FW5PJεCEEYMw 4}ϻB8Q$E/P"Rs#_%Fs)8ʚJ˩8XPwL}2W3O2@?!r v8vQ ҞY9 E\I).x}dp>hϬi <-+h%8G wRY,NJIxcEiv(g?a%IUf}OLeV8,RWDW NOZS+C } Z8K47VRVZK47[TX3r4m<%J;[)UU& W $ɷUSK=VI(oU*pl<Fˉ I) o4jr++M&4wO fRAg*Ɉ*RmEm3txUE˟v#;U_+=K}J+z+)<TZ`}{nmGXSoN&b B_ho,<fc;[ŭ8 3߾ѩUcD/=fYG^6<-ZRyM9fvWxY[q[I+ &㷷 :k31g:R%C)LVe}oRYy}o+!@6P3j[@? ?*3}V9ˉ( 1T |Ҕ:aC0@] O|L̟H65<(BDiD\k5{X@>j+tGDϸ<T^:c)1vrUM;sy)nDap5䝕+l>Ff2EUQ`Z9z9Y"ZbA68Q}]\aEloWd ScL 1btV~+On1 Gemɟ_rlAUN5:u\Sѕ 'S*f4)xiIHMgE-ѡbߣ!A{yAm.N@N85'QOԝH:8GРUՇh*N WT <a8QmA7AAo F&(c8Ei (ެ)7&KqxZ'8tyjv'E6d* W z+zඞ*f9id!ҫlrgH@ S˿iY l ^-UϤ\3쐲[uL8M5cCu"ʧZ"5VFG*zCqJ[!Ph3/. |`PWa큩YX[\> \*ą({p/o8qW8#@-YK{VpKLkeaNy@A$}yvTe*ϦzA 1ʑ ,gvHyʷ_ » $ƢBoZ}ãоGj߀N; üJ^M8ո< p1}d5uʉK=K%17tq@-MY T74S/djahex_X2tqWjӖ &`5/H&ԇF#eRmvϻE^cRoH'%Ly?׺!^3J}")m{=;\_ZB_J[ N2yBԷ9 N)*@I$ALt?):8B`{k>H\sn{x%v_\D>+Z$DE_yčZ,i*@V]#zUJaZ1;JNI&EI^oS=FK ʱ2#2J"$0=Ke}Ѹ!^OZe)ipTvkDgi+6V D&[na3Y<(܃ ^Y!:=97t%E.C0j)AJqo?HƱd:89ګU |HeKnߢ#y@:DϨ)!SaI STΊ@ʆBp #)1. r9:J]"6< U3*A{Ol*\62)r7#[$t $I$ ҄ )I$xI1)RI$ Kj̙Z=8j$'2_.xt4]> Ui2K*#qZ"J=]fֻo a炡°K_ܨ)"IVNr:^buN։w:&un<ǂ[jYmKPS(bu`[JU~+[Sdpw9xAkxkN;$K킚ޕy]xi3G& eBy,= c? m8璬U>Y];yt||XܪJ-:_Fv?,$L2PKohqcOuӲ~|a*kxc tÁN zΦ! XCg?GRwQd=kL(DʱO[ QO`óGoS),l1Q[5ZpU=UI W*xELxS4DTYZmkhU ;(ȭߜgXx /")4HIOpجPS$2J Fm`8JD]BmUH!\MF4HҕgYW U-r@TL6ЦRwb%/7d4w]P3~VN|-㰽!oȳK^?#P}^euT%7}~M%zLO}?s鬲U+ r_u"$ktWOfSV59wbjR !@UqV%T+ cEpTRhXߤBǷ/!;;0uЍXXY .ɹ<{ZQ+n|U:=1#X6_a'{jʳUazP8c<6Dum4$ <'jGGax}g?%P؈xCbøitVIY#V)ܪ y$PEQw{*9+7mVd99^#AX;ZIMI,}^gಱux\(*$4|ɟUV,%bhtYYR ,rkKeW*ƒRɐPs+Z=M+9K734e;+ $J)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$Iw3%?mҫ?Sȭ+plsϟ8܎+-juϤρYi$JMI$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$K_FbXZ70~K6_ O ƥ?X+{G4ITk7RI$I$I$I%)$I$IJI$I$RI$տ;1i[σ\<\ԒI/Ig%}RU6i|LcPrBI$MZI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$IB^g׿[.}{uGGI͓/gSW8gSW $RI$I%>I$I$$I-?Z}"xsGdc3e ZI3"V_c{J p BdvLI%WY-+L8.7>LݘYHBųp!1rA*0@$BB{ #rD9x?{Bq,7 TTP+cl$'LSJI)I$~U1}FE|7Rgp1Z &'eHtLdTtI<,-WyΠ='f9WLI,5I$I%)$H-> Z7蟊iwђ QrCKI $kH$B I V;a~p:~#9hTSըSgRp+ ,ve&Tyl(-d{x+ I#*x"ҙ4-ٞ8U`T]vxMn>NIQ*O@.S4wW f?Tcy BQ,L RUHBbrfGtw]E)&w dRT@k2֟ qyg&>K7U\/^ivV1iUFc6y\Di10GFSJPJD8;]#IE<<9D"E#An DJ^8@c;;%[:8Zzz5nqAs,NZt>A٨TlWWD@!N%.}bƸ{U*8;zsdi\˩p(m]#OM '8^8h̹KUD&*UR.Jz搊<|[7j-EPZ e 0SHD BI%hKTѽ6ފqO[PB: Rp tД!BhbZIRRJPE5x!8"M)Jd 1I+SIH2@BJRd)Tʂ))IcDARКGFb4AVj[TW܁ kTaDZh J oRZ=hB>+(] *M@=JrS/!8xCVv#] 0Զb5) 8wKg` cj[@:Enx=>ʐȎM: ?JKSt-SEq~G }h*XH$!;^N@SMEO`[I:rcC0*HyaOQz {%vI!H2Bٚ|QqC=og5XtCu:˱v+d7`[bO`?(0Pi7 wOc <1Ц1аOW#gr.귓Qu9v*?HJq xQG!U#\GxzReVgu /^tzdIC `f5)hdSzj}Ep+X:e8 V;h/9cO)P=;! BR CSv/>w*㣉&{ ^:3+ XX'l=^ F2t" 흆E~Z%LJ^UO: N:uϩNWМd `"[@?њ+-dHU2 |U]H\BxdS o-{Z)UfZFak"#X*:{{*n°AB\ ?-@! m_'/eGD|նt H+zk\%D\O tSOvR6N.UWnMuun "0:߮){q/Ζ=ȮMh0:xSenqZǻSVhscY UK򩩤%efuKw*63?I/nOF$)-F΅ES{nƶ;†<(;BKYஆjU F'gY}y-$7X['ZD.}skg^$* |YbϦ?I*>Uy5'D]BO(#k׿B7<]|GU`T$pRJWKqIT^'7 AC5$Q $l UN}w<&9u0(6aE!jqcRR&ݼ CE 1,A0 QS7e1ʏDmZX5ΉWYm򱫻YʳT}DdaqyׄS)mTaKaV[yR9Wp'U3hlުinW{O(ͣrƅtZ埿N-X GC:S8yFo|̓*jc`k &wOuí"\, u{9hb}?+•,ܛLjL2#=ѯ/i\K-*~upזKRSeQa??C`[T^:cx%IW'(a0ːך(ʁ!fKV7[ %4lB݂\Hr :^uOב#xZtuB*%&ltS ʿGZƱr )Jp{JAײf{\`fW78$軏 u- ? zo0?z*>)MJHPlB2dX贛fQPXd$$ZdH$R&NDx&)%,tɊA#H)t'Z]0ޙZD+qtZTe`k?Hx(M(#)NACDtI1HxLS0"uL&J!Ls_yE3aU+;/,8Q`IOyRC&!:HޢmЇ2)c(RIڟA:&(;Rؤ?B=xUAE>IBØQT-%tMh :)]8 DX GgRZd"5n,P+Q}YMՎ gz#ۇ`hjvYS iW9L9!ar?uz3m8!ڨkDRc N}sN}nŒ2凓z3}.Pr:~Nꑧ- ETupr-p]la-|:8tY Gh[kc7?U蹟74ȝR;W@ϭd}&rlxyX@J>8h?RMi5:BcP@nS-y,G@+xpkIfKS~Я%pd/G2NGf' yR 8,\omY;VgG6";6vXnnl0aqyU 9YzRF*`Dzpߠf:UΟjQJ=98yJ;>D!"2)I#u6,0;'W6rvRTj% 0ͥILD_-CydTuWxP0 XգBq|Vv'rvBuQD3AYbl+7 K׵qRSq/J%-D#] \nY8h'Q VjL|9X+N]RK4zFNX^GPWѡQY#f"$I$EJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$]LO["ŷ+J5?7#}&| Zs3VZI$RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$X/ֿ> w+otV ĮM$UԒI$I%)$I$IJI$I$RI$I$I%os>rZV3)_&'5$KYGIED|y|͚_1|+XT$\cPI$V$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$P;WGj˾y^o~FQssd?6z_T:_TI$sI/I%>I$I$$I-#@tdG.̥I$ꇄ|Jb$(eE)L蘥U[`$"TMeXL[sNLXapTw S=QW\5VHLZ &P2p>cB(m{+C#Qc!3p)tK]߅a ‡;)p^5R>ߚ.tYT$5]JuV!QGrιe]SDTĬVM'drB҂T&m Buqe~k<Z3H*Beܿ4VePj;7ჯu~' Y =[ mv)rM3蒵 USd* aI~/*!Z4s 8HFoQghpyCv(=7˚$ Uߊ} Vs)z:e!+sj&7"ƻ݄'pas bM6iΙ[bJREܔF9H,m:]TXB6-vf$VpU>SB)Bm $ I% B(T% $-Snk(mJJ$5Nx( JS黲sYjŒiJRJ;LM.hIa-NkJoL)t$)'4kǚJ]$Qj4IJI$bETRTI'H;nFIVN^JpTDPTGs;R9ETPkI 'ke*UAөo=ԽH'mmS7*JBI-w,o}P/ BbSjPvHG^iTI I@4\FxJ]2h)ACp1Y_2.0AM{ jG8/ 5%#TP΄k`*hDRAhk;/)I ;D~J4R9,V^-ݐE VTF+Z0j 8y(PU #S+DRڴ3(i,8S B!;:}(ĭe&)33z`LH%S; ZJi-OU^?'bW+V< 2Jvլըr@!J CyQ[!&QYKݣBlTuIu yT̢]c)*AB;0年V1Uh[Hl9! 3 73UȣVFG]ʾZL7TkxtV@UGM"DBւF> %Ya- GdS[죹Grc)*+e|˴*dX9x1f!DO 1BJahk 4s=n'_[*#T<ԋ3 AU M艻w*$E'%Hj3!:0Lt*DJQ('31嵵f@*L5uBMퟹ u-ӲA#n\"U 65M1N>F! $*-ii]6U}\TA_<)ժikUS,N|j k5W8D$1k5pyiV~+)Uڭ6'#0Y+kHX9XDzGP~ Qv #zL53%OGȂۢo-(KlcΊf!V'HV2hm[V]Bn$P/J8yz%UѤm+Z%S> V8ǞuW8W02⣖VD@jˇT[Q+/WTN?U4rzY>_D2!Z8[2+!EYZc~c7y|q ϢF鿻W~[+25-^EeI$@+8#Mx%JjEkI3S#^S$R)!0E+A)L rRiuJa%/ O \$HJhXlYX %I_(:df-RI'NA$tL.RDI7*M2vItnQG `Jq|ɐlJ;9NT w~)iH"Sҝ8*$d JZ9KS0r'iLQ:=3#~T~ ?PV QY¦%,fI&HI&JS$$Iá-wLJY(NyWif,V#> C!B!1hC6㒁glS RM/P$JzsTOMZ0~`? =DD4e;P `6RQKNz Jd,Wa?5 syo@QuM< dpyU+3yV++>[ _3.HR`|i"@CFR`]IXXq7~V8ΰsx{I\Mt栛 ^#@u1zҸL;ށZ ':@u@;jΨh;?y=E['Oil&{wCmd&qQ+a,f Q'-~|%YCUej7R:I['> 03I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$y?Sȭ*3%?mҹ:'?/#I֧\LI$ԒI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$~Do`-#Olp,j[#8Gq+I$Fu$I$IJI$I$RI$I$I$I%)$Ii[σ\տ;~W!IqMI$}RQg%^_1f|4y? +XT$I$ժI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$.}{u2^g׿[2Ox<.5z:.5z:I($KI%>I$I$$I+r],K>*\^+Rgp1]rtT̃reR%"SRB2~.%mesgR#W2IBJTI$I RI$5#m[8]^%7٘r) 5'V{+@‘rbPSS; CTx=AaPr^EDٙY & yVH EM rSOeܗ3zµ;E+==o5+; QJt{$%NRRI6K WR?@,| UJd#YIsI'M)JRI$*ئ, *k4|Gu&<'LV)]C""Ḩu TDTbaI1R19Qy 0KeҢ .a!4)]Lt'I8L $IJQR$WGI >KڂGcaoGI|XY&J,\]dYdVzPXH:'uO򱇗$5J\Shc^Upe{6'7Yj+VOI{(dA!+sG_{̪Y TtjJ:C@Bѩ ak)rVxmpNBGUG-m {(pT[!M%(,NB`Q=8WwdƖ?RYI4TuiؿP;꒒-RA=#($ۂtOM*Btq" i2mm1`*I+ɎQ[Kq DP4Jnb#rAcz) (&ng8[VÍo7`ܢܣ klg}XPu YҚ~U鶍@eCUPBܺuc@uY{9iP-!o D%+(nƻ 8X%jwOGD't~ q#i*.}!*_Y[S閳=H ˭C&Ep#y#ji&Ijb.iID8ܔ%tI<&jRI$S$IZR $I"Gt$$J$O gHhJRI$51k)JS))I$s#$IFy*A(LI%x)I)Ji)$$O:qJRI$'%)deJɓiO>VJkI*)HT)x)AT &И D*FSK7]Hg+)IĪH\eѪ nEk!V+.Q`*d**%g`TkeZ5tyVYxSƨ#RL._;[f02>]dɕw_O'|VМ%̓: ]0s>WJ]mI F3,Q.['%:Omy5{64*rn{kmj oNaM#[4)지)4)pKtsA;ଊɟ)% k$c斘E@8’@5D蠜A5;(==tRI*Y7IrM"LXT"vWV:UWY—#NOCCl+y&Jԯ$cC]fumtMg04*"Ѓe{R EuZbv- \l ЈuCNZ*`5l[AuZkP}AP7<[M>>uPOhZwe~!=g/O;FUZuH*m)=Co-*Qt|Gu ^:GkJk)ULRґ( zfVxp*mk . :H Ɗaf${APqܹz*PqMJvIޭ_3zq=B)w+  >!SS1 )l)$Sd:sna%7 @RS2N(NMTSA(II\Gޢ0JNthx$ Kt%/J]vMOx:o &pS@s4)*mD$Ғֵ؄0NJ0AR%4]T-l*NyQw7"A %SHWak\[,#&sᩐT B)*h<|kn_v0ڟЮ>|R愒:T e5u[`Dp? l꒔̎d@Y^ 6D=CE&CI' PPv^Q+ $e1I$JR)I$p'IJI$$H$$JLV Bݪ6W/$u Up%4O%n22 %:m)TОRRO$!@~tH/:`'H,ޢ5Q*RB.oK%ZSC$eIjI%)H$*Y$I:dNRRI$ S)I$ jb]G*GfQ;Q)XD$&0#W=B ɾY8H8)TO*$ɅSL<7t4W;(a K9BJVkaa`ځ%U PMV:Vu6΋$T?h@Yd+E8pn7!1ku O0\ErO* m |=},J ̴wR?4S(%],i( [r;R8,_:H>'jKO ژ4h\=.Uڇ@9"Lb2"}ROVG\pw/WWA JtJ2KQZib `ġ{攥$wW J Tō=wrS6'9*:ഺo h?)~]5t8MNJ|{0yڸ.Ҽ5gUC {6}R^2$Ž~%Ԏ7ғ hcݔ5/HGÉQ;N?%;[%EH Q .{5C)…<7VY9 v%G$~۴MaC`T4D}2D+}õأ\́ѱ'z0=P@C)ƼGWOwOJxjk bfg_׊*|P+l0|/QcફV]`*kаIEݨRI$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$]LO["ŷ+J5?7#}&| Zs3VZI$RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$X/ֿ> w+otV ĮM$UԒI$I%)$I$IJI$I$RI$I$I%os>rZV3)_&'5$KYGIED|y|͚_1|+XT$\cPI$V$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$P;WGj˾y^o~FQssd?6z_T:_TI$sI/I%>I$I$$I#aP@D;maPOj`X$n] !DX6g(\!M ;D !tIO4MedV^W9Yϐa;ۣ:>VJI'TI(I$$KGtGiWSxX GXH)$Z=|6VCe.)(aV%ArkI$%)$LAE0Gu&N crq(Hj^Q)&*+?4e(.S*),SPÎ@U3,TGxt3ޔ 3GBuiR 8({{QQ\Kȉ@[@+-ޥC<)FB{J5!䇗 *.w69"2+dl1J[JfOLL$N$%)$IŃ*T}1S`5?LwRd-BfxJ"&;R# û$RwI&ENS1q!iD(L@.W rROaD)(WBII $d))I$O+{mH]nc?Ѣ_+ 8\Y=./ךkGV[]ULp8 5fӝC<`&|B:bUwa%S#.ZDSC,Uζ?LOȶ>5Z> k;]Z<4+̻ھJ .c]ȐC=BLׅpi[Uxcbuk"-q:.b[ӨJC4yAٔ6}<>cU+F[O޹X##R\Dz%>5Zu[#i M߇c>J A>D-  $IʪDp#P ji+摪c鿕JOu!a *l!?"&k:q RIL=CBm&d+?i VJ*_pN-*tJV*ߪ攓IC.!846wPB-x%H@@C4w;2Z Org#P7T&I ͽM*b TM'Id̒!$D+˄FfyKwt)V +Ik75m6Z Gb!?gI]kyi[MDnH:HBkx!-ӎ*Mr8oyXħe3I\Ѭbº_Dz=.}i%zSt=}fa\9L.C= G vY#4sJ,MB= Bx%;Igܐ:7,GwW o$K<}3l$VVL:mR-qIRU_>B xWf4gJde#ޟU>@UӞ{)aҗW L ɬw ?l~pvĶ-FOo\A<-WuˇޡR (VTR?d{)!JU3jY^qJoI=Ga<-JVk}֚;jjcn75(N@ZSo nDyi-m%c[jiNr??%QlwVp'uD0 9 CvmmruƲO ΚxGoM+TcLUX0K׿RY[ȞcbD,#7 }&;z:ӻ@NejgS;>j0a7d;h]!7Y?Y[$]:$!MR^Ba#CVh`J2+Wh8=ѷ&ނ_*&AVB/ۏDn0&;<}D!hhlK1"} | ~ 9r~O24QealtZZ|!$ٮƼ9Rk!HM18z#LS@*@&J_jTk=VW'6:h(<@)Bi/P2^@TlZ#tQ@BS>С#]ZN/{ g:{jI!W}m2xRah V 65^Ӆv6*H 60v[m{s{Zy:Xúe3Uafl<*AqTTⱻ1DdZ,?NHeXmM@Sv:V`e[W&-!"6SYHPC,&G$bdyMr eSu:9HBW)zׄ5L%3TReJ?Eڤٞ z߹;m j3 Z avy(FBв4Ud"t촅b#hhݰc 9 U"eo|Q>STn(خidc8p `ˇp1uRxB]9FLF'FK67K{]c`WqcY"S8> }~YIQm{Ut;iQ54Q8)H:/$hHܻ(2qK!0xC8?4VA@֞Ҍ޻:VtK%R՘P8(;-.",5:7iQp'_I R@$G@(Jm5BtCKplJmA(`􇚃ySkt'Tˊ@1R!!m-cX#*ac^ j'U4 8 QFCD [*U4$h{-/L>*=C:H0$4]I d$ôjU|_eH6 ZDruKUl?+¦ڞ腍hA;$P jVX*X'=L 6F>iؤ8=L5)D8Ry N#@n!E1H;vII@I0LQ\ǹ4!Hb'-  qlh -wYi~3#[bOYZT܆܆|s$?u#AobAJPV a v)j!)R>HhJI)(j &Ua,RVP XI+S'M -jI)L(AK:d"$$I)0SR Rb1[|CAD]v/y2 "Nt'qQiXjS@'NA)'R)%BLtI" \$43ԏ-'+3CDH2KcfI')$I3'TQK)\,e ԁM)R$I҉M(!I$ IRI$Ef瀄8.@w(;)Bma*h9_@Or&u]dE6i4N]F'DM<ړ3:4«k4APA2SaSvAoNf!dtH-a/-?yݏ@"OIYOzbq> HwS8,xCkZ2Gޭ^U)pPH=U~\cG$j3d/Koo6!W􊡆&N8YXf,]O (,% Q-PxU2 ڮQ[kC% beJ8B^4Jn|Uޘ5(Yքn9Pba=֑TFddZ郺nxRm%ZoDp(!NO!«N3^o2tUsrnY7\B޴YD|UIVW}b?Z?X ;?"Yݳ!t}I$BI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$y?Sȭ*3%?mҹ:'?/#I֧\LI$ԒI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$~Do`-#Olp,j[#8Gq+I$Fu$I$IJI$I$RI$I$I$I%)$Ii[σ\տ;~W!IqMI$}RQg%^_1f|4y? +XT$I$ժI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$.}{u2^g׿[2Ox<.5z:.5z:I($KI%>I$I$$I'a I.)hL+Mp<1܇Zؾ)@ ^.-ntHu+;z?H+ uW@E5H"k!bBc@$x=я E"$)tI$I$$JLVgM>Zat1eb#CH [RI4w DB 5;.'L%P6KaW wb uj$I%I$u:~PRRa5?LwRI$'P]hdFtLLTI2t*ٚU䉬Y=A L2I$8IJI$R*pRbԙ:K[k Hc1^XJm";4ƫTB?aN$p[ʐ|bQkK\$-;X&;*p댾OV(p)Jba@bá({yI:HrmkoS,w:+Q0i'")=5Y )! L=)d TKOi df:P€i͍=_@)գ"td𘥒NqrVI$]O>\C5^X2.N;л4ۣlW̦ g>bH2p9Y!D윉Hrf9# -ӐAӔ$)){!V߳S~t Ѥ'3{}7\ o/f*=L2Wipjht8>:V_nOu1ls H4n+^HЧj*x]0;pI^[nT1cN)`kވCXD3XZ*uMYq:"6G(p<-iBv½ʧIC!G/QVZtyQs-kTnk'h;zqgHFr @nXiSxJ+Fd+6a9LVz1x rJ/ 󦀡VWWgAke 4 @Z?id(+]J%C74#d_C_ UW4v>rJ[<#5D8ͮ$h#v ܞ?"'7 oR&\ĺ1h"(PZٍHsWYS+8*qk1G}!R5@oŕ2> oYW \^uf5UAcvH- Mdd[o[5}_sdܮ]uӲPҍ=P!,:uWU4 |SJpQ M(gr̔VH4Pbd SM2S"hT&ťhP1"CW*ܭVT[<FfS=p۶PU(7!ݠ  []V,ԝӏb'uO "Y8r?H,;f oH3Se*.hGGVՆfKRe-ZE<1㥼"x2Ar-*A:,2'a#`^*@su|:8*#}vO#][)$QTw(N&4ET[I?vțɡ Υ$.\;&qDKbBM#S hSr&t9%R'S( H!TM@AE{?dU"C1EL}Ζa 5Q~L1KlpJ=Ȑ*M/nMo@h"$rRp" )9瀢^'RP׎%-x ;N rԺtc35#65+ g]JnS)BA]eT]e91U*@*rRSB_+! D^ qRmouҖ`)FZSQH JDrOg$qJLiFIhY=VFaXu@Km^$?&ˆm[LzI\pNXQ8[[S`2 O P'WH,CK H[4܀\-B!g.@T!Đvdب2٤I$I%)I$)$I@wP:' *~e5uoc{]4EJ$ !Df?V^tT%!}4L(Y`+3PViit%Yg]Bl( Oϣ鏊|U,o>)?]6MNS5;[@Mdzm `G>KHJÉ#D#J)dr1Of _ZY̅|JΑ!g0$+7]zu2t%E&9}}H$)%BϤa5 VUg.%I/Yߗ I(! d&g/KP:'Y!΅Kpή5p}}*ZTl\9q&duKW E)=cU"+wC_ )̕'N|UҨ?>g2ϗTUv5QWo$n*!M$IF$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I.D-ZUzgJstvN _G>>eN+-$IWi$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$Ibk,[K_Fb?Ka?XԷGq+otW&I*fI$I$I$I$$I$I)I$I$JRI$9Թf-?әwKCgtkI%,#ढϢ> Jc/i*.WI$ITI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I(]+~#5zeAϯN?#Uh9ery=/]?ju/]?juA$P9I$I%>I$I$$I$I)I$֤R(x߂!M\I2I&AJI$\j LMkjdc#+Qʋ+p 9+Bԗ'[&Gu 2RepPc;J-Q- iI'Rftk!iOZ5ݸQ^`ɝ ڬYX=6AGVodR;u}`nk(6;ĩHS('B ~WfyD#C|tZm-1(X7 N#8=})8V践 hMpY׶U+'BHOR^k !mbFؚy }#DֿW~'৅25 L \;*o$w8wER`'EŅ9%P  'mjZyL]fQV6ZHAv8쭤Vr ۈRnA)6;Nl5ʰ[i :ceI(KUhnc􄢷1CsRWY܀tLTB6l6ƻ2;XՊ_?DY^ߢe+E7U[DnSO:*ߋcy P%cOH -&.NBLŪI+>N-k iUښSI\sXᦈb:/PSt$xN.)dJHL`|Tš3RR$Н0pqgD4EJI$4)IC;wtI?Nnt'$$JeЛrciI*I$'gX!*Bġ > JɊxJ™((:e?PTIJ$қ{tS =ԀkS:ЂM)jR< SKTڅ3Hʓ\ߚ*RtБ0iNAL=>e R%- QTr/hAI*$99a)j^%}s2*,|~oZ ϮtQ&Bp O*! b;Ei: T*`!ahv:)%Jt̅SJO4FzS)IM'ѧx3iJpAܒd% :iLql>(;$%ƾ8{{^,;#7NS9 twhJ ~E\v5I&)!?%iC[v+]S)PIRS ɕdjT&/iM))rIAt ,𥴃$j8)VHNS )n1 )Q؁ipRU#HD m#h *k]qB#]!;:rJ!M;\Q. BL1R7Pb JE

փ9UƼ"2ȥ%SQ21ڗ`FӵVfgtOyNt ]! U5szq .V*͵6ƋQ%WuSUtP 1Ю2LvQZ{\PX)QvŽpM1KG#!ɵ-[Y U1A3Rq F`:*wO-ըUljp42~y&tfε}f j/i%VnvAYP8+|rl?wkj޵Y>U[I,Tf;s3{a+im)έp\3\𲠤p=x{O}1~Uʳ)3U"R7p8Zxx'޾xV* ~Q]K @L r3P{F>NU\n,y[9cmN#6dfW[MbQmh~E*%H$&al/X%$ :RH$NHS|SΞi)pe4xv}3 `ro򄋑 r~yy)$8qQI2JTouRDNCbTBHkwRR3/L}0 i+LC *&1d CM)٢P==ub7܆JupUcy X1>ɇxQG =),SKbXG!mm7u W Y JRHN; (:e^QQT>[lU62`K#AiDkr8+4u#iGI›i4d'2 2x)2{'4C @;wMBE:baQ\A]GP(\YoutWaHBⱽ5Z/ۊ*_ CC *p˾.kݘ第шH?MoJv\(>W1YqS-n& O%; Pbw+OhYiߠ?["oG}Px'\|M~sKɩȐRDV?|35+eRO# VMz|Vz? Hݾ O*) F) ChhS(}H>zR~ YW-:,aNd+}0{Qu[*$Q:cu%V sFJ\H,dp>*z|2}@Zչʦy!Cs;&_ou23 Z]f'YZz噞f:p76iGs%q-{LpkϾE.10?s8#'@a>/F8C+-tuLq?y[i,Oى}҉OݳoQ{9i0}ǟp[qt/8~Xlg(Ɨ?U -8~?y[i,Oى}҉OݳoK؏?K_sy?yKN?'>Df'7J%GxnKN?'OVKvb~s_l#sW_y%'OR+m%;1?vϹQ/ى}҉{9i+c/<[)~g(>D41wIodIbOݳoKvb~s^a_;?V$d_qtm?f'7J%;1?vϹQ/b?0/}ǟp[qt/8~Xlg(Ɨ?U -8~?y[i,Oى}҉OݳoK؏?K_sy?yKN?'>Df'7J%GxnKN?'OVKvb~s_l#sW_y%'OR+m%;1?vϹQ/ى}҉{9i+c/<[)~g(>D41wIodIbOݳoKvb~s^a_;?V$d_qtm?f'7J%;1?vϹQ/b?0/}ǟp[qt/8~/ֿl[u U5{w>18̙33bNLS,q9KGotSbCv0@X$HI$I$$I$I)I$I$JRI$I$I$Ng.YIfKn)D>?awxds5r\[Yk_v0?{P;i<2K?Kkt?9u.O|Sg҉ϊ|,5Q/Ɵ⽨4%n%5ė'>)D>(݇?O^? Os?]bKYk_ ?oKxjp?džIw?[9n.%ϊ|,5Q/OJ%asWƟ$pOsX>([9i+ڇ?O]r_[9ˬIr ?oK|Sg҉}4Cx.kt?9/p$?OJ%>)D?awxds5r\[Yk_v0?{P;i<2K?Kkt?9u.O|Sg҉ϊ|,5Q/Ɵ⽨4%n%5ė'>)D>(݇?O^? Os?]bKYk_ ?oKxjp?džIw?[9n.%ϊ|,5Q/OJ%asWƟ$pOsX>([9i+ڇ?O]r_[9ˬIr ?oK|Sg҉}4Cx.kt?9/p$?OJ%>)D?awxds5rn}{u'}w %QrO)y/xOc2H_G,gt3]?Vi{lcsH#y QVI$W5I$I%>I$I$$I$I)I$3PE@3\yi\tBbBdI2$L-n?F$: v+m.|>+u, I' ʏ 1%,NI+c7Z+凩ZG@nH TI'Kq(!JL%{vM ML5z%t89\Y1D6HݐpqN YPcVJw43[8C BߌrY2QFV*K)ВsDPS51'L8NI$I$N!I$ڠGhx#4.wKl+ຮ\(uH$R)&QLJTO )t0N\2t]bk*=XCxV733rɿL,QtW [ 4EV+/ݕJ\`|VN(l{umsPz8x 7v-{HyEr v5 be@C?/QŷFF 󖰳U}_ElyYփ0KpWt*4[3*2!^j|/Gmny.AҖ~Z S,eU=PlkV/^юE)ߊr!a),:P&ex(!jԁIVİ(D}Y$BJ>%oh?hc( RMm*~$X !xԄ70!eLdIK TC /& Ίಷr_[ J!mp9ʬX vRU$JX) Cm)QuNod">I)rS':2 3rcR*R3P*B:P<$[K ,\FRg#Qoҷ %Z[ᮄ) Jx>ܦFꂢK+!yܴ%eT%SэTvt 1v/~nmpZR76 VI h;NBmYwbYO<$tky>uwk;m[:<}갺>hL;-H 5Қƣ\'B9aV5E!B ꒚vP$*W -K@ o q8o}qy3-՟pkQmy1R,#2#V 5Rm .AXyT,!]W#VH)^ $t7eF)[-y-t dɼ!QM),I$IJI$KqL+*Rd) ]G]Դ+NZM`Ǔ];F;{TJz}s;{rW# [ʊezpӟ؅Bq JU[YgڢpׄDʈ/C%p[K=!oCcUS_vG/)$'CSQ5:S tq|B8b1]hCE4'D۞Ψ'Yİ)kސKZ,dvRLBs?y\AnS|Q$ޑZBuIEc=QOFR3YMh!d:+'E&ƚpP$HaSgMRaNj.^[-I xK)$LwNRI$$$IJTWzq'KyEJg `g -&̡U)$AOS"TQ*-HJ;7 tg0g5) 'w 8-ՅP +׸1#?kȾ}+t^B[.ĮW} Uh+#s[O;V?1u:v~?2 #Gws=;[OeQޮ嘬fYaz8LScGeӾެHoC4%}B!X!CͭA92}<1d,LӸG@2 b*?O _#T?Yt6rPY5k[vI@ayG^1i Pΰ }HFǰWH:*GhƫY'J]Ku@y> l4rU@&BR&LRיjTo:*8Pu~svT{o«XAs'K;[*M2^逌8ZVfVXYi>i 5mi*3aV U} EšI "you*ܶ`HUCjvS00@X6q>iI$I$$I$I)I$ϴ5mRvJTI&LSA*I$Z0pVMեi0S;Qt 윭ȂtАQ)RN*MXndjXsЏ $RI$2tRI%{Bfө It1eBH'&R:+JX :PPvY3O "„=W\H)(’Rq MI3lUtQ JT&,I%fG^g`X8\l+@x|ŒZBĘKxLXǰvP,#Vސp(ݗڎR)K]L=wJ?憠qy*$%K|rkXmea;I[8yf q qFBjg,xVDLS)TTO)#ND,*QU'y3Q(uTiRI$$$$KO Y0.7>L5 Ph !iJJR&TJwR$-Pr5OGp?|?9V>(}\D<3upZͣz!,c"/Ґx!`_Hpiஇ8Z^M[^|&Qe4*$(?b#+ ÂfUF"TeA@O(==G*M`e-0Ѫ'Ow<7,V"PEV#>+CH;\|O{W*ɍPY0zl&Jά}):xYn cgVDniԇTg[f`*]tBp{ 0hJk9i[m̅?4"fCpUgKkON{~?:,\ЂE uNvh%s:EU{zET0.eζBWUBl*vb!(k!"ºQC (K.%pr{u syl;&-[Vxr4%$jrFa!b3ƃT'tGEIRoT&>*m >!]=:%1~iK*I &*id𫐜#zK)ZJ;܃ B蔅)Zit;܀5HE!JVd(e8j(> '+M.[l' %YR=S)I@&6\1>g=g)Jr;$' 1*w`qiM*`g?8*Mb}ʾ:sLqMSJz\N4P Rkaiiӣ)X`Zϭ54hAYa-v(鵎uM9b|@J-Gl7ip!+F[ũ+kcx 7`u!H\k->JyKfΛc(bvA/yT\~G\ZH츒WmL :T}"ȕ`Kw6hr>[> ,)[|YK pO*"M&GQȺw=/XjSX ςiR e" IRtC3="YS)EoC(![xR8G&C-OovW#ANM$]M0iz E./ u#\QvhL@:MCs)uֳm1/:J(iÔq~ rHqY67=5*rWQ~+.IngC0B;x2$'b,@?mՀ}tF>ì#ך-0|8 [S4TV'"X%Ҝ FבN~d-wt H&2 A)L~ a̶S:LhR2)IH\KAն8#ȝ;S!fO(`:#ʄx+* [ ]nKfAϲ5VnPA>Hf5TEbӫ'hJ}N;#x*#觰L PJӌw-!DϤjTOQQv]*L!}HN0{":{d6\[$z93n#]!W ;ݸ rHGCQid(U'c‰yH!<ZC_UQ[ԚjuWj M`6VS2:?˫p?X2I/$*`y&=Y!$3(oLƴTϒpӅ6nײ`u )cipn)N 84R:%j!r&s|J(uEϸ GZV@<4p,R ~4pxLYv())pc;yPv;hID6tV‰3 JT-<ZݣUP5hSnJfbdi䘇j(蘒8AIU3RԝQ;W:r+Fs%Ċr1:%S)FնGt@MqpgiS+D5"G-_+Z5^wM1;Wqx u UG0Q8y#^ jv's P+9bZ%Y3G4k]eĬ>ClsxEI\GSlpR&}s֮ ̟5m~F >6a,,mgWvt+3/LHTU2tJ>qV/4dbLMge&`5Ó۟ެ)sqE؃(D r'R;TmB/ ZMdղ݅UGu %WNK %@%sݤAb2d]"v!(SşL8s: ,۸Eg6]I4:TIV`NI$I$$I$I)I$I$JRI$I$I$Htﮧhe rȈ墒I$$e_Zhs\>mȧLȩe1&2QQYe$c,ܤe(˙)$<_s)&xP_ķSjp߮m-q.a37"goE.Jڜ?뤛pKp\bKLȥ0Ky?q?&<_s)&xR_Į_O~I$?_ /9!w+Sjp߮m-q.a37"goE.Jڜ?뤛pKp\bKLȥ0Ky?q?&<_s)&xR_Į_O~I$?_ /9!w+Sjp߮m-q.a37"goE.Jڜ?뤛pKp\bKLȥ0Ky?q?&<_s)&xR_Į_O~I$?_ /9!w+Sjp߮m-q.a37"goE.Jڜ?뤛pKp\bKLȥ0Ky?q?&<_s)&xR_Į_O~I$?_ /9!w+Sjp߮m-q.a37"ӯVIrG2Œ1/k$2qw <9?c.<& $I$I%>I$I$$I$I)I$ p m; :2c@[< yp"qagahe[\>Yض7VOxpm*[)\ao"!\}-w G"q]5*oeOee, D$R9<_U}@K7kbWi8!f:S![%D9=ԛxpªtC+O5FvǸnx"kDu#Vϣp1ZXuȹgZUv V`*x+ENېMV=Ct)V+Sڤu`Z\OA"mMB.RnA /&LjXJr;rm%Ix  ;Vs!e3n.4&0sӻZ@Qu4١ 0^xSnAC>B-ɧj .bΕ[i@<}B#rϊ+shgUxGT異wY7J{yt,˞T\DnMfZ-飖]Qbл#U^ގ 2T@%_/c 9jeSnrT]nG[oʷS~j2Yze NZvVbUP5?h1v&LJo 9r㬫q+p7s8x(2ք]`¹v:(9r'S B u4T]Κ+`h/ŎҦ*y1PowN-BMk:gWwW:J<.ɝ8GBb^T枩'UFhgDb-#O|r%[/P}v<8ïxKx, 1TM"I+U؛N8:*$-.Squ* ͣjRO;9}h![a1Uߤ%.jGe!; =A zm~@TLI}~(W;NV7*SmoL4r} GA-o *w }q6˾-t(p(jiGyheB,3 WWk* Gl6PS!3So/~mcE]:Q.<k&)ä2W0TL95AN›~:PB5Mݤ(&h(5FO>ZvD{'LyX6crlK*_dx~)ƒ`wLYd _`p[$ju;\Ev1l\1PT#{Ot;E5U+~Ыʞ73:iku=|?E>cT1[)ӸSQSL4(I<$lV!ki :`=NMWHS8pu]Y!U|jqI O*%r P~J!ϊ#.AEAKvnI =R!Y5kT@NBN:@(?5*HWhFze٤+TMmyD J1aRZN{j+aLXIN'SiH/kFy] ?cSХ~ )5u5Fl(^Є#L)BަbE iio`~VMg](cPۛAVoapNAc]wR FB[8[ŁgI28TԔ44sD@c_<U~e9'bUoP3mTHBCQ Χ`Ѕ1Bn;N8N1<ltq T*Vr=p!ە/"z:R}(i::\␓1@8P8 xv"D }^Ϊ}^OjK$jG!S4j!\,*&3P9a2%LBƩJNؾpuS|V:TٜYeVK`ҢiO΁d ;ς+:h "S骉g ꎂK#[#Q 09O:6so pT@H.Hl{ƥXt#T! 8Q% mmqD3u51ʎ=B % jī1RAOB@%ֹꭊhΠ]t9q׷޴Gٝ+P䔢t4؇}E͞ kxz* ʱԛcP @sFҒiiSI^E…RTi-%R/A&մ*gp[j [V~76oQ + KOI-)U80v l1ݐ߀RfA\-pZVDZGCM=\xp ) |U:4Y' ѠW@Bؔ_mġ՛* cDIo) 3ݠ+Xfv~*~^Fv%.%3IlZ*q " ʉ[R Rh)nP{H<HIJ 㼡L}3C+Y/1҄uI<$ I$ 'LI$<$I&zV⡺"W) Hx.tҝD d(pR铦MQ-{&'L8)NtQ&*Y8L!=cqLJ@rJ(MpSxQq+8vR8cMcd}2} W%yp0N:`F$IyI)I$I% RI$@+8MITQP+d R ,25S 3$R!2PNJCMR)RHOx 52 hJCwLBJb HIɁ(dVguMbU.t~Jzx@j)2ĕ$HRȩdI uJP*,I%}_T;I6+^mn便ş5as] N#@:X> ~+g1bWr^5<>,:uc^n@~^W_ʇ:4@Ox(ͨtѡSm^t%$?/)5fY'] >ѼT+:XLq{#Eik (&ޔ&T7Kg@ӓ?Tbg3ESaz%Vfг!2=#lQ:5MED}@~4%Gh ,Jk?Q_ %Z-K MTBIU?(s)*Fx ]S~t%FnkaM[{,˿?w3F-vju;`Y?%2,v0#7#?D5YUk>L+do=օDJi;~)̃cˆH*RJxT­k$N-bf9C#{Re$J$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$wfwfhA'#/v_=s\I$$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$Ir_)\~j8eRv~s?KݟsݟyI$uݤI$I%)$I$IJI$I$RI$I$I%gK1VVzgS|Y09I$|/[G@eurK?ћJ́2sdI%]I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I%_[?̾LggLs?Hh$V$KI%>I$I$$I$I)I$ѝ)z.I\oOv|b;I,u`yR&&rGT‰b2u6AY kRu*>iPee)h\I$6 ӄ Y"S3,QԪ_V9[.05SC*lC[pK|B?!<,$m0XxUrb$ |TZ+?ޤ y:{px'{e oDŅYO:Joa b)KJe9"$LgԵsBK,䢠2P' RI$N%)$Z=0UMu]?(o |XQALGpZR$(󢛼a"E0NjR%ryeeOT)$*I$N$ $JM:OM>Kț^_ FEHR ))(x )$JRIUZɘ+c3Z+z:tpVsDfe<$>HRBbޤDM b?Fj >2KP᢫XkJҧ)s◧_f;58w1\S聍ƈjUBuv{]Lt u\>*4ALBv>tYWalUeWCݜGtGTU_dX,<_3Y`SZn =Q/Pjf6ZHEJcMPdvL/*bT=HSmC5V@:RRCb}B >jϢAԞ)Jp SR8vQ,#T$P#$$"6Sm%))hM I+6*r^P (W=hRmRS%J^Fh$7,,T)Rm{!; HWa(ZE :ۀRM 59,Ƶ?*Mdz%=|87d36VOrk872;33/PU`~HV)_Ξ;,GbH2E?y qwuk] R+ɫIωNkw*"G uYê9Mr;:Ngb?r]Q"i%^ASMz aOJBIFHӔkB`*i+k=ԛ[I^HԈh y T6*К8)hM ug@a2 B*{dHKj;p -RV 6U04ϊB&Ѹ8Cf-Z{;)ΪF/V5Eձ`K`ZD/] E=AQ:HL5Yh#]*6bܧf;b́/L-Q{A)}(pGVoIITIY'%qUm&6 pF-L%酯>+''qqKV_eh촶DwH9Y>M8QnSÇ f4Z[V)eL>yK&ܷa`~VhLD-ܧbTuCNp=<}BDŽs0B)MƥPROJiVH8TTJiEM p@VބdzXǻQ± SQZ,쾽@ 8;;DI[G(c;JYbήLpqRNYo#"A%R٠ՃL<%C,;h<䱳>"ǙX\LOKS2V4 j;̨dT3?#,ݡw-:):&:mR\uIôP{`hRL(&)#UW~JjUKSt@fuOx*;)NU#l;].A5;I2 #1<)x@S|s nнIIUHvEՍ&8pDAT2OkIYJ~<`jŒ}nJ 5yLq8GjZ*)X㳛h+K0N[!)RC%KutmP(c*˞&n-ZqsJp-*UIL_` S*>wdbSFTBm܇3'[~8âm!H[< :lȄEj5J|4)ڡ Khr6 }wIbT i%j%UuۢtGnPROz;.p!VAgs*l !2PBU - *mFaHh3¯fl3!әVT;w58]\Ok5H:+[\uMsUӵDW7\N5Em7,k0h5EAbxBFH(kj`rcQ_gpK)Yi Td@U/,J8vQۨQ3s& MuE+HЧoW *qgT8U SU:C zFc:4¦\8QĦ-)K)ۯ> ~,qE!k;*UY<|R 6{#t(w9rcwH\z#b+}MarmWzMˉƫJcr)$LG.q)1JL[l WYZ L9RHr(Np*<%iO)UMV" IQ0em٫LW J%d*F <4:PmjI%&RM(I' )m-:tvX;uM"5;JJ`XzH+:T 糏M~cW*JŲ ,o!ib6X .)bzxB<'m{$~:I\)w#dp5Ih10 ˔K_[ ^>+r|7Z>dUۢ u3 8ElNeuKqA,ƺ=ThX$đ$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$^.wZ.wZԼ89?t9$}eqtYI$UU$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I.K`E?5u?OV?,JNgu)tV.}tV/2I$NI$I$$I$I)I$I$JRI$I$I$t7LOc*~/?ދ&#$^~_̷N_?|Gٟ:3YI$I$$I$I)I$&;kY>+ cGdUaWz **aJm]{3<*QW\LRY=D*Ͽ')6I$RI$I(ZPk #F>}dx/HoA\LBx[%2Ih"%(%)|ec%,g+#81sC%4ʢ'(iK+MϱY IOs4H1M%w&g* Ū+k(yU)$GKG[ I%NR(ea$]rYBd;TR)%y8iAv Ue(%ERV^j! p/)dD&FjP<&8*VKEDꤘ PSIg!YOhYrجb FAdBxIWJI$(I: RI$X, ]y]Í ` u!?$ )1N:`Hҫ aX̍Xeb;1#+J+)I2B$t铤$I-lod\ O4,:p~vj\oqsb!)CܼXƓ+YM]7[kw\QvweO# >W8R,,MD{Jx^O+Tj\>k_fm|L[0,z%dE>1~l{GdVmՑN!I 5\ &Ҥ.=6*+ Ȅ滲IVı0l) s[cUba>m$#Tƣ&E )iKrPZS,k A%&b RQQ58p<t8r!%.`AN] В:HT/iIKBP%dZۡT>I6jd$PcϊPZ"X(&2H(Y>›k;B{+jnX<X;6Mo#V(n踭]D *|_.BnASfQҢ:F˽HFHm!Y45ݐ_,o;i71feΣS1EnMnT~Odt~3ez҅ErG]P u[ Ź5d.oT஁3hJ%ZW^]qˡǺ_IJ=}:GAK 3,r~i[efdkȷATOM-Np<}SYRP*3wU>{: ˌx_eq8-ʖR *$G,وsH?%a "lAE(`R;;RFǰ8KP:A~I4薫\c;"uIܜ'S ˡFl=Co^PL)!zåDqKr{H O=P~0C҇)QUID'$VѨ:yO1€0JQM* w:%m՗ kY>WkHY:jh2n]'ݱ$GS[BiDmSe`8ԇHbKYʩv3 v J?P\ktnZW[f3GNHyP %М%4NE!IP()RhG^$D8PDUZ<88S 0qҭlVsS^$D"ઋ| sP:h> eغ*98ŧr'B7 Q4O O5>*f9DYEJ)&d.krcl:8i[UN\7Rm%EA +%Gy oGլ Fc['S 4NsQS-> Mk:%DqiL@x(.QMv9Jۇt7V8p8+OPQpMw!o/Q-eR-pM]ŀCkvKN\tj4)POvVN;J"A%AB ,+ΰ: gMN ֊n&uD|TY+~[K"TNPR%$!uctUp9KZ'FN,Aܟ~+Vƕb䯚g^Ʌg>ShPO Khsx5y$G &>hIը'JSLd=*|ULxB~?n9)ILR7[*,:AC#ToiH0 ^=VZA`H jA)M̔%7dD(;̂%\(i 0l$hw grhs }%;*v!m#Dؕ뢷n s|1HVͭwtoSw ˡELf7vZ'(ըҭv4M\hh|UJ|)pAR()VuAA8hd^#$/C'(b)6:*X_иunrJ x*΃#UTj &!"bTI$(_<(’D0L!8֍)I$h()TN:Q)rSJ^:&RNI\J(vxVݼ,GV??EdiG G )jNSNI$$RI$$*RI$14`#qG$UrGd''{+!X|$$yH3%)$B*T xCw(; :etvmIs8͔ 87)}ZB ]!@"V'h 1k[[يWq^sf5٦1\|[%6!H+^Yz^Sk^|J`R9*8*FY8HQ*+F)(,[~[VhұlEi|O!VjT֎:nl'.DʃjKܧvT }4NQHGYv&XF<<]~(cCܥSj(UW^YgeƏs8\y*և{<ʗ$򁬔MVZSq)4pOrԒIcI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$]V5]V5/7C/O0n_I9Y]_zI$GI$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$K?O]jS_UO//_C|]՟]՟̒I%$I$I)I$I$JRI$I$I$I$$I+=3]??ʟɇ~*I$2߂:-#>sӗO(_vgΌVl)S$I*%$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I/20P~WM^e`[? c?g+ DCDX$)$_I%>I$I$$I$I)I$AvguMw\Z:PuuD+܎xaI| )uWn L΅5ڂ! /x faS7ZʰH ʇevxH)-l:LJRI$ik2VM2Z_ ?XpPLL&L8EKBnb5+nX֏qX?XtGoPвI$2I)RI$H,\se2yO> BrR`h )&NQnIz,fX˄u^a>2=}Lϸ,6hm/6X ji-fuΈȭ,*~'|IVPd%$ Ej`VxDpECT2 e;(Nj+ĪD]%'Ta@bF M!:[b-[ ? wJ~S$IvNa0IK$(]L' J޷XvrV>LrgvV8PI? ,.I' ]$Ii`}YGwU !؈b_VVuic Yae'=ݯ]o= W7AxLD] oO+Au#G@IR,M} L(Ђ5N׫054- lT0Q04D~D!Td 2u*zW~WG9-<* ,5&[Ξ>{8q[Lq{+(tPۙGfnEqPΫYv0(Ni쪿X5Uı3B's+!T3Z vP8`m%bRfY(!O:+;|dm>kj e79%? K xI(B S}|J9*.ȞJ,*[l)IJXo_кm+~BXSR t7>kQhJgzaBhDh XV;p1䨹u: 0u!biqEh;*8B(2BUcvuv/5#x=Ǖk >RARSu&FWpuj[ՌA5(=+34lpB8t'CI庝י"<֋ a<; wWJMgM#PKN[a)H?8 z R; ЅJGdoӪF @dh8Q%HG+@LDFp/4 hx)VwT2S 4)%~k7T:t5SS*!Vƞ(ͪmz3_VR۪Ujf(=T.՟5NM({D Mliqʙfƨd:.d:; 'A᥮(PxHL-/H4nu ^3:ŃjOuS8ò )4[ ֚y y8jBp(M'nSr6$$Z. NǑ?zdD-T ʁD)"hS!C۪4 ҖPARm:Ƨu̕{ʈT)/B2@[ߟ)nFC^Ô3F&58}tRE*ł T{u"uFurd$pLiQ$RF腕;r wvqAp뾩X yOܕIM)4ש$JQqLXJ&? q([JӢZ&o $SJma99K>*3%<I%I"RLuLRAJK~v ijaV%HdpЎI2XI$$dI)NS$I$))$-}>Eux?YȻSwJR%0Oi2U 'ODOLq .9KJp8D 4A/Ir1=PJUt =̐vPSjSjI.eI$IIJI$I$RI$dRI%:Ǹ-бl3+[4GumD<(ipT@-I$rpuQƣ- $:3 O=RI$)" $fgVUT1Ί&9nͼ)(IbE&C8BM- %hxZB؆a(=2U—ryAO(+-_ ݎ1a!?QG dHZ14$Q?i1kPsaRgPgg9G ֘ Mtʴ% 'xe 4Rp $72A@)p*"e̬_U\7sOB#Q UE2ṵI$H!%)$Aw(^ >%˦)3f;@"k?,7H'Gx5;j&ʤ_K)P~!ZpҨ:E>J^O<) %(8CBxW& 'VCX㌰w@DߦT%J ԒV<~^h}4{Τ?F4_ deV˝iKh<\,q@pT)3BMhn3_Mkt앛6>+Sdh>ǑZCNK-LlE4If-LI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/Gvkvj^o_aܿr>Go8?$I**I$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$%0ߚ|_%'g_3?a>?a$J']I$I$RI$I$I$I%)$I$IJI$VzgUegK1?ETI/Wet /[GX|/lQ#S'I$I$$I$I)I$KS PYkGqHRd+'Dx)&(F+% Ef];9 B9Kdxdh*>QG Hc_3HzdA\bR ܨZBeZt! ʯ?e)G yN B? [/?uL񢏩Z bQ S& Hh-$꘦u`#*) nRܢn (􂹒%,Wrr<#Yc9 VV}ADfVa%%|Rc戒xʉa en< n{x(ϱՈ|O{*h*&VaΤN&vʭ͟,CAl5´DztTua6 sy :X( N$ҒKCaY_BÏ~j]KihjTY}:lHW<֢^˫ .j4(BBchVKTt"[nB>?r#%W6n*x@}X贱z8b:c5%T>8'G͐b:`VaiNUR5m(+w)ԛ jtVx)AGюx HqrD8pRpU$BcAخT(bˊ (;8Ώݥ%%Ie6PL8,rN]ӭf*sy:NH 0p<4"9H*]$NBiJԤIڝVT% 'F.kt(I#jb:dg3@ ?RRI(OJM]R6GrQ"uI ;<@ӔTI;BOdxRҥ)$RsܢmMIJJPˊq)JkBxI$I*^CS% BJL.r)T?P4@Q{˒ZyO T\TtvX)hH*%*% [@CgT;@Ml'*L2;\НA**" Lm.3^uFebJP'P&o*/q( -RkGtT|Sr[Ua dsΜ!JbrD;T+Z;ʲrQ[K[AfC~K *jٔ.ybVSؕ6OeE[dRKQDi forrGϺ:7T fʤB\9"`('^VDK9ĉqDf@}6B5]P\h5k*'To\Ehc]Jb?`mgp -xw;۪ 0 ( N&e uD٦hecEA'[MP=v&MTdP/3AM}Y M̜y23wUK]-v4N(<(#C$$0{*А5UGw# 槵L #6GbJF㪁q #tBg3`jctʆVFm#ZmNu[d%O=iUaT.we`iZZK^ hTnvQnTK†vR[=%Y\!sX\D+ *8J4ExL$':{%'R-%&hg(T(UZS)qRxAJޡsbW#pYb*gÅThDIoww]+'5)L+e1x?Rs^k Ct)nm؍C8~ U! gkEeuG4q] B i4:uDz)nH<7FkH /L)C JIaf\n><*]j]\q SX"B,!qv>WOD71оbl;rXx% |;(ڤIW!?VZtGqeASN,kU+ GfCtXBq IL-((z%KpS V$R2S)I+'H TIT%H8+ϤVD'V?IG Vd,uI%)BxAJI$S*RI$H&NRI%=|  @GuxA]ӧKc$˖I8HS:Ɖba18ZDJJ^RI P+CTy$%&&)$$I% BI)I$I'LI$2RI"R=kȤh@)&N8J^I(~IH$eNDDR0K&!I%SWs y2jTIRZI:I$I$RI$IlciXGi?$ >FirDT2Gd1H)LR>!8*uBI$Mj$(9EE!1)%arSwN h2f4T9JSaFd$2ĕ$JRI$$8AܡBtD6$)bMx)$2lh)>A`)&"$`Pc_-%K&L9Rm I6J"x dmꀞu^y >~ސ[Yz҂GRǿiT.gzXE_HB"A쀮f9 Nk=b\pQ'E&ѥ%@8!h2E%MxDxx!碡r Oġd:~(8ry &?>RMBB Y6o{Z;"# ).>̱d'`u>HS•Dc^,piYV@uU{O RI$I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$]V5]V5/7C/O0n_I9Y]_zI$GI$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$K?O]jS_UO//_C|]՟]՟̒I%$I$I)I$I$JRI$I$I$I$$I+=3]??ʟɇ~*I$2߂:-#>sӗO(_vgΌVl)S$I*%$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I/20P~WM^e`[? c?g+ DCDX$)$_I%>I$I$$I$I)I$JN>wre$ettI2p8)L2۠{0x>bU RBuQR%NB2J RURZ"?R|MthHL̟FeX bcqI S- Vlަ 9%bhy6zh-vV%7<huz0"j&)T%z4J2!%6;RӚ &OG Dfeu9:A~-KH|ѐE%I@X8&'B3X+Sf$vdQ% ܢ0)ɕ!(HCPyAJ<%I d[WXփV#tFQ $RY]$N`JRI$O m,:[m>lH%R.VXd $ JRI$xx-[~X_bu Uʰ9N$I$8JR%)$N9[`Xk _/ d9E-KZ {1J*$Š|)_qRDT~ʡԇP0G.-$ 'PhO%o CZ_x 7(]JnX\KèquTy;C=A:wGXBZx%Yba:9&6,d6FqӲsObD)Yמ etdY1(:{Ni].<8..[uW5oGblu TUh849X WuCqT]WՅQ^ u\$MIqX 2Gl}q0Ya) D ڴp!%mۄ՗UXB4̒aU E6`Q54r}N,!$/L ixEJcJo#F吒`,="TM@:9 %Y w)ܤ@CLC$+NgvIIRC=P Oe'G!lp0p)Ն@RnIUp7Wٔ3gE9K~%A6@BP=V; m?si!jai?; ;HUْF̈́(BeΡLu7鏹[5JACj*R -6fw-BCu*ݡ̆?; '}չM!4JK7mIvG X@!VJR.J@}&R7Pnm QT&EKd2pL OtڔI)o)%jY$)̧EK$%=ЛOJJY:I) jrRUt[BpBAJI$Jv$ RI$! BuNLNL9;!ʐ>))I$PM I2õ@L&"SleTjD$KS!)4H)8-e8Hy$Ja1> MKh'T SQ@"TJa\xLS(Zle; S&F L\HDyW~;FvTp&?H")deWPTg Liw 1@V(Q ?c y{I*W[esʧ^#VDOB|Y}rXyN<"H58 ;&HVRS=Pmph.:)XU:HS%@U2R'K7knY<<2ҶqeO XN> >;wQ5^BxJO)Jʴ$&HA[!djQR R:1PIŎܧ I,*ZoL$5SIu Ul= -8Lu6y|G8(J>GIiYz/v(%m?*kiJQ7WV1òZy CIlHJP%8+-C{qɇ::d)O -7D; 8R,*[5Bv-J,cd,PO-Lq57 =kqB|,_ tE:r'((1!cOtӨVl%`SAO(Q<4LNI"GS)QR)I%9+?vZgB1$6)RI$˛cdI$tRI$ҒI$$I&$RI$J~ t _[1c!BRݢ :P$0QR$$̧Jb(PLH$TΡT1ϟוݓTZI$RI$t))I$I$JRI$vrIH$$eHV:Ehu?C$vFLԊsK*(SB*Y7*tBdDlGy* Z1].@ *vUHU^ku>m9|XQiRq.kr΋ NJ6Y"t0]> l u}cv'|!u&^l"N#+G^o.g9 5YdI-lxOb__I237X<%iߒƤ{vZ\C9GrrWeưi`\Y}"NULdzq+EUl$m*ri\HvMoH|6hNZ*D"p4d`u%DJip-8GTeEGImAN{!}82W ~x8` <_yY*=Y[ST4Jf-lv*Ka LщpPy Q66*\tIOSQ{TخM u[Mחm;fҝ9#|ZNپ­DWM$U֩$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$^.wZ.wZԼ89?t9$}eqtYI$UU$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I.K`E?5u?OV?,JNgu)tV.}tV/2I$NI$I$$I$I)I$I$JRI$I$I$t7LOc*~/?ދ&#$^~_̷N_?|Gٟ:3YI$I$$I$I)I$JM0T՞b߈@&N &RrM\I7  u$Kk8, k u]f#pL "چSrH$'*$Sx^ 1e'7G"\I$A.RAJI$Z=8ag-Z? 5JSPh& q v]iҜ#mLT ЭjSSi-L8C- B(d#3PIIЬX|C4w<_UDrAD> mPGT"SB2h bߢ~ R3,%MfUnfG0O[D@8Lk1|U P9S9pBJ('9I1K:4!mXCEI [? :H/Aw(NBd"\$'LS$++mrG_TKSW: ! "J$IR $RI$cvZ ) QY>p)L.Bb BJRCDI1Tz^O7*+dOO*2QWKht+{qsOWeKfbDx^}i9^Q'pyςA0RSE8Nc‰I$ɦT"׀9q>I@#Oʥ)B|q%:G>F5tDu! ނ;)1ҧ ЅnAiь"UtYyk`Qv$-KU((d#Cn8V_p<&_ 2*t+H+Pɾ*@f._\+CN-~+zH`.~kYܡupJUWQ[ءU#B#sw ? ;mo3+-)Jݩ." 1 v ̚LWLw-nW )J8 ɬ{+Rt vr>G c`'o]iд2 '[ .K3] [ǘ$ tken I%I[8)C8* BzmJoX)XU6 OzȬg;J_dx%aT$?3ޗzxF?rpRfZ>ov)x*4 AhOR1{!S4f֎7mR (tҦO )qYM(F\>7g^߽W zuQ=4*1Tձcxk:+LT@*Q E& ޒ t cY@w֜s%KboI\ޛX@]Q/\տ[Ѭ%TFC65uFTNU=koryni*6qtBIV^$*o&~ tM!=k[ᅲy:qN*5p vא& GT7lHh׹NL\tPS{\P!M#NgqӲhNJUf: wD/Bnal {nf@)CkJP!.qIEjb% a?))ʄ) 8Pu #NUԀQgb,w BA.Ij U\Bes01gHnod|)&Q EO*LbtAn0*web߬VFv# 9HHEM`?TYh+f\QMSQ5xTVQ7.4Ί5Qq1vjIH Ͼ 2S"x)OdE f>>&]^!Q4p' '( S T>(8HGYKOlD&$PZ;Ih d̩r#*DJIA<ߙBkLpn!(40PuPdJr$b*7"ȟf{) L"zxSgg+7 ]*UInXV8")CpH%4v_ulܢiCʆ{BZ%n:*waȕ|6q T~QA^]/X SJpGt^d]4Hwa"8y&dOI5aRH%rgv6I $IA I$J$Jܬ{Bo!m=o|LwQUVJD -EIPtRh S)L2hj&PR8L@QpQwB8QXjiVIU\~y1YM*lJI.H$I$ $I)JR' )I$$ddRZ}8iVL*"/@CkiV1v)i{V/Yd>U\'Y8Lm@Bb3k+Yc++ci:d $+TI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/Gvkvj^o_aܿr>Go8?$I**I$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$%0ߚ|_%'g_3?a>?a$J']I$I$RI$I$I$I%)$I$IJI$VzgUegK1?ETI/Wet /[GX|/lQ#S'I$I$$I$I)I$JNnecnEgA:v%#u&q)_[vXҫB-, ;?I/1b-iSSNMtpV$lCeda[^K'o8L~";Lv6ItI$I%{HTJ~ k0_ ԡg j/jB`o .r)'tB _4:d鞱 ps=d|Ti=xE$JTI$*$I RI$ȕF<>s*C(oS$J 1))dr4WƊ gB(.4f?8}(d!byY&?&KI4):'Bm<9XpQ[c{?0!\HQGšmJdoRxM³{Kɰ%ZBaZ έb^H*&l(}+ѰUt$$I$I:ͬ]5<H7rpWd:\$ILyRQ:ppS<~[UsUyxd[('rH"}^\Юq"ͷ[C1=6Y>.pm pLˊPV -UO@Y*[S׷ ׺`a0uP4=S'Je/5 BtO~EYqDFU1lS-ktiU$%>幅H@q2%W VhWX *iǠ*N8Bs2TeDh]cD]ajSjS*`:5UB)VNf+_7ᐦ. )wLqo 5g+0i m!|%G2:&iOVˠ w5f(rx! Ί} ZEmQA?Z-gܭUp <:u sLh)ʬ#̃?wwxՀWa8j%Nr2\ґ] *5nT22A'JuQ*48+fkKVH)[.ЈO@ALcL|pVGu/T"҄+ #TOxi$bX ঝ\S8jhB*JᡧSؠzwRm$G%)bT[xKQqTPSa7T†"i\d(ژx*݈IKxSaE-)6 y(v@TBTBŽge-Y$@V IF(,8J;F{:vK_c@H̹EZȭQv Bz{Oe_`H[or\Qre%2=6IM0Kz[Z45Y.~-'^֨V+]<]9ưvb졽liKgYS JnpK*A) oHUC57ǍRhS oL`sipƅ&5' ;[ jHE iPkn6NNAD-(3o*5tjKD* “k喔-#TO??E\%J}ʂ5*˺{P-G rcd,&ܟp+V>Ve{& #s+=EqF{R&SJ}Y2u:J@tHX МN&"ZK`%#pxDH:xJ'iq|2Jkg*sܖ@wMyѠs`%\]YZ2lFv\Axuop \7|B ֪ƀnojvY9m+C/ߢkPhS ? VV^j/ (4شiq@k4XW(c#ԙ SPJҡT|__IR(vxb49H?5(8_L^=oW/y-Vg )V` yU+p]C.*<7dCMD¤ Ak6l-,P$"U{~;L6Z*Q3i:hbi|ɛ `DŰǺl3 GI$I$$I$I)I$Hm?ia TDŽ{:MYxBFԍe C rR!"E-a)JVWQUiЕ{AYйl0*5a 1O#XV+̱ՆB9 iO;K]e`*&gQfK,YHr?ɒ<ե +I^3!E9óUxHPNAЦ4?U$Uuo*ao*^KLݚN w a HүBS$S$hE":bVWQkU,Υe|S9RG?G$$ITI:pL5Y)D;-%+ys M)$Й &:$J@c\ raXDu8Ytҝ(XHI$uK"$JAi`:"V`Z}8#h|< d/ER" !;7*)Dirxe!4yOck4;&, o OUH<XNao!h![uMP3v6 ?=O8%>5L!1 Md颋gVk㢘y%B^!L NV<&=7lw8V]8*O !Kt#_%[tMu@{R) kD+WBc ^GE1Pkp9j\"6Sx䤦d&;Nx$&SIK&*DBJHM R6SBdBR)mh? *AȂB: m L&)R*U~"b;-VlGt"5ҁ &!*a5 AtXʃh*\$GWo4SnV^9<aW'*tS>T!l",ud:U1_%gƐF7MgK{9tMTZ#vQw=[>j.k!r4@sgd8\pVG>d^:yrdyr/iY,Zv[[u }8HA8$hŋgvqi<3TvW6S&kAe1*T'R/!%%ZД'IXnI ~< QM, i+A c|IKqIV b $,!%[JTe C$|SJfe(BS%Z$RЈ˜D_-J2(SeZBH\b(j30VXn-:N* ʱhWlY>(e  ˆJ o *LsBhOq IGfG+=!r6cL+JmZvd+*uOm*Un(hCsPl2Bwʦn'B[ PUat)ٌ J.;(RaqoZ;W~@rQm9œthAWqN*_)PM30x!YS> ST f%[pPt#_jQZ%0j 5?YZ ;D' 6N&dv5RI3v x :R Jg8V+k;(%`5iwtTlz*ٽv  ;ݔ!h(MfN`lO.i2Kqݹmp=ԻYU $FAI͐;I)JŖ;]y8U^! Lvrcfn e3% HEsN[DkFJi:)&%eA~*$@j1 YLDm.R B~aέd[UDF4I$otnٹڵ{*!D)ta';TOt;& u}$R,:0ZÙZm+7}2 QjPaL=J{B+]3pWuAA<1|#PSk%8(4XvYA,LZ zr\9H<)h)#QZyNImt)KI,o 5rKʮgV'SmN:RSnn/VpyOTA$&-I'(3o=6\A&Fe&ݴ@)V0X B2@S4yVTw(6Q.@*J٤# L|՛0I]ly)xk7<^SrG Ar2>BaxpZx&%~|VucQA\HESee$@RuzoVhM}*Cr1a9Ew'J+Yl~*سxQ 3rsp=]%  O^Қ{*ЗvWtAiЕi#`[a X-@ wQ1=.έkyIغs*.BvqR" b[Mdr4F2VaQ4k pp-l^d3-0:N" '*s Od rh!K쵻7W}^d'v\ˬS!)W݆ r(8z"|cV:xjGvƊ8HwZbGGYyIt!QgX$J+zNBRNGl"`:{&u#^]d:CTD JQ5ݍNHVu ׂ6)OdT>tZ] F0:xTxO% mr?Yt2v |pQXm2sDAXL2y-;:U^_K:rezAtQNV2ܦT`SHPҧT;~JSNM R;)'-lHpIҝ5JI$$I)I$IPI$Bݬ{Ga[V]o%d)!(Hh׬e:IrBP)tIJRO ILI8)xR𔦔b8P(+俼wL-RLI%I$II$JI)I$JOTU·?) ohpt3X) r{&9Ԥ$QO)DҔ&"](EDHId|VIZZVJ2jM2IBK)bI$ JRI$$I)I$RI"$KCpUyTpq?5 $OƊ]4AKh.Rd&2I)IND-Nt 䔰N)BaQ> %)&)ڱ]RܨF["$R#KPv ൬M\g0 ։VzI(T0tP28Jܛ6v#p>p]&Wz*`+VѕXdr/+M x=ܳqHr^6ؒ~ p.p?f\n'Ax6?B>OG- 0!wgH.w \%dekaZ煏h|CLQ ʰRQ Jx_+oUq߰ŎSf́Y$JGa|?-{}%o@x.1 W%6acˬkGdle(5DF9%;9H*x+RvqR.M8xOH;I)X&xU1W*xZڴCß rHHҒV}Nߢ՟_XT3 شKh@ 7ʣ^9҃o)i>+-ڿ_3cI$hJWhCcEcԌ1Xm`U:Lvj$(XǕ;f;wJKB2I$jI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/Gvkvj^o_aܿr>Go8?$I**I$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$%0ߚ|_%'g_3?a>?a$J']I$I$RI$I$I$I%)$I$IJI$VzgUegK1?ETI/Wet /[GX|/lQ#S'I$I$$I$I)I$I$JRI$'!>%vt]^#;RpB‰! 8Jz)&HYLh ZK腒~lViy񾓂c2M e]*I$IюAI$l0肱+&TOBTA1 S) H%hCu vT eT88vh4^cy'iLL*no!FrefE)Ʋn]n;ύU|P~O 4+ nBcPΩ&s|9b0;TKL fVdwan, GpB)"J!yR [+kK77VW@-c?Q@8Meyz갴DpSֱ!cm#Q*D+{y \A~-oЀEzY.𼪇9<7]2ǻ@ &V)&z+ƭ24V.}j!Ǭ1>-%fTZXG2`&-T.Oаk6ֿb҃ PPXX|Sʭ)$io*%i#Y!a) tߤ5I5 k7cF[D˜wNK]JpRP{&!O',ITC9 61HjRS2hX#LU_Aᣝ%IAȆ&5BՄ"5]h |0_cAPDt,v:I*OYU:Y ,h̹kk%FȮI…݈S{{8!@N pL%^iFiI6ˆǥJsma粖>kc_*Y#" y *(iq*\A-2-'Yks RJ s4!S#^8x| ͫZ xeW|RPOHdxPiPɟȈO3-JJj/Hr!^ȡjCڤ=Y,*I:+=*!$)5A!gCuz@Iʎ))ݢF LdG*E 2t#e`$Ǯ ]3`F]䝺芒8&4L[[L.a=A Ʃ˄7Ke tiMڅhpCAЅ^ SMCIWxKN5`Q!@% 0YLURS)-(k)xCG:;̩4' WQA>D%Q=Hw|OS*d!TCgB<\V䬰| ')zz)*SMB XAIMQ`<諍%J2x*]e[bE`)ٛc]GpWXG܈[⭸C%DYgiDTZk4!*– SxUhED 'k3VZe90Ǣ bIƱEt@CH])bTTl{ji=bUg(6P14Bv+4= I׺S ɑ(n4@eeRV{+5맊 Ъaq.y0H-WWʇ!\T*myB1ˇ7ձʾt'ׄGc1(;.jC':4Κ)! Dq^S;amD\HbYԝVoH|N7ipQ,!_*D4f{+;cVASfCy9(xtk dtx*)|?4zqy+@;R*P=> sђ(IOY_^èZ_[*}3*>PH%QҜ8!z(O"cI"'@JA2K+K G3a@\e3f$(I$$I4&NJRI$hYKs~* !pL4)Ϊ WPʴ$yRR)wIK$)&$91*\I2b{&*\(R*^L++ =7,xXr?[%*j4'Z$I$:JRI$I$I$JRI%ϴJӇ^t`/dHjE딙9I==9[H GS>tPjJ qc~)d~>< μc2&B@ԏpVlI* I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/Gvkvj^o_aܿr>Go8?$I**I$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$%0ߚ|_%'g_3?a>?a$J']I$I$RI$I$I$I%)$I$IJI$VzgUegK1?ETI/Wet /[GX|/lQ#S'I$I$$I$I)I$I$JRI$ހo?iXWr=7;tİƎѦaV(WT<%YJ$|>Zk k~L=K*DYVUZ+IJtTԤI$.D%I$³ʩOj]^ qT4KBj&!8 B bRP9BXU%A̋/̓ M,"IʱI$'I$$H+}Oh"e7XŀSΦ8#VL+QiMJ&8VcVC$B)Q%O1'gP)$ jdI:\ RI$JԕA\Jg T' )$S$$RRIeW;ZʷʯљUyxe[)=M2M>౒V6RI:&HJ$xNBA'ǚI$VCn㼼y!`ַ1n$PNMVc\vnwc%u{Y]eDj="Pi2Ч*ԑ5]WqʯOe"SrRQ12FM#^ׅN!u);M>) /̖Z[ix(W+]: j$BijvAueBR^⎱w -kă+܁YW\AXBEiً[РY{ TD,~}OQ =jB)J#^pFڝ84 ՝U`TR$:T]@FHR*RSYQxV"Qv5=BLY ێ(1RS%(9@ GeYņ-0v)),( 5NmwpHh{(IJr1<)HyH8$tKNbҔhbgRꘄrGe0 D꒐;Y'Td ̄P:Ja cX'TŅ/P%)&њZyQ8./U)V8:Uwa ei@LZޤ29R9/! 0x-A͕td)gwK in.Ӭ72[[QqqCpyw9fE_E l ӱ-NJ.(I#:}\<ՖujV`G*znME߬#r\3I#~d6 h!tT8CL"wA'zZ1pCkrꏮ!`?UY<,'tK6Z ^.Y:O f8B~ k乿wZSwҋBqhCݗeb;za%/iot0vZl}V)@N\Ӎ\NC-$(#sːU`:# (G!ºܧF`1hU+SL>*xiJ8諹i.oܜ@RCq̅#v#vؙVat瀍f %?iOJJi.{6Nh"߳Nmlk1>k INuLwSM !>i.+vm2XljH18v;ʃ\40́榃=ݾ?4{ֻP n LlsVB d#7geX %[OC4H'sX;C[UXSV[1{p2YZ}&_@O+xsv4J tPCD;q;Ӕ[i-0uU^-: 턆?wU`CvLpӅnlX$k枧NơU:쑵%f6,s¼-ebCJ)($ǖi 9ԝ ZxN+eo(I%pԔף>3C#UiM槣5{{(qʾ'c]:uZ-UC\GVʐ2v}ݒCѹuQ,{uK~ٯ)Ru/oera EZ%Z}!)O*)vOcSM$S)JJArOÔPt$)L)nC%:JB+>*Zk"g>(ͼ y#Dj6j8T,swf<Xd7A#B%)$4jDrU4{07;D7<:vS4\ BIH)|TMü@Ù!5!/0) X)Od$pAxP"-ׅ_&eX$vLHFU9+tMT;yJL+R PNFRTcTn|h<֕Yەe 䫇B:%Zmɠۡ52FUw%Vurmߊ KґdJ$9hkAV*!j4j kqAଓ:XIM!65Lx?v(g` rQnJ 3j$h =~#6،**O$pGm[ۧps1檽Yx> p]Un^.(gO{b @tDRM %ˤJ$“N1IP7RQ@OS(d5!"LrJDbcTLRJhHMɢRBQ -+-q V?pL(X ʛrl2e m-:ui \{*IL9~MDIh7V?7#xRA'BRGuB-sTq .470pI qOLӇbz{ ,$0$`j&$I8Q%&IJH H~ IKeBuC G>I RhEIܦR%Er2ܱi$IdRI$NS$I$I$I:y$htߤUP^hyJB*ݖB3@(AI:.2Ac\H9LJ6NTa9M0 *gQ(QvSn*D':|SSTxdu4Z3jOeua*2AsKI;3)I$ j &NJ+[dJV?+| dl>yP`<"{x!"gS PO!͟w \v"쾱ﴮ?EdPmDK%r /;Hwoh-;IyTQ)>,`wdX'wMQTza #uB'++f&w g\!=?b$77J)rN5) 5U cw9~^urUNVxdIlz7@{BWT3iW4!?"SL‹uqS!%P{awU&0#;gC*%)S²ayU>*"VNJt Q.Og+Zc8;kvvV);JDU+ +,{J WaUY牖:` W#鏂F)\龲p<\2&{XUƪI$I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$wfwfhA'#/v_=s\I$$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$Ir_)\~j8eRv~s?KݟsݟyI$uݤI$I%)$I$IJI$I$RI$I$I%gK1VVzgS|Y09I$|/[G@eurK?ћJ́2sdI%]I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I%_[?̾LggLs?Hh$V$KI%>I$I$$I$I)I$I$JRI$a"7%ziA^rNLWmI\gSxZ貊J?+rriI:]'$&NpJA|AdImT\69P2F> g տ7$ٯcCØA ίѭA}">J Ƅh>߂P D.!Em9Ing  O s~tpVSʛsNdBu ^K,҈ o<'P)IKlTŊa"}D)M!%"z!<r*䔀0 hFk@K(@N,IMw>y p5(D֤0Sܤ;<#L&cKR;)5tRuwp!0 K-JQ*aEϚ~S[dɸ OdDM26RStOta1tpJ!Iltl-0r%bPZ@F^pꉻb k_$U/WEi=I"o*B"a Q_сEтV}xRmʦ Up .vDwN/L [p AV*1 H_:ʦ)p[?w3ӃLm˼a0fsRG6'{!›pf!@ᠮR8*ThYOo<:`9Q25#U&+KTEApx4fA$ޠꆺBozʦB!V\d Gඍzhvʭzz^Ujҕ*o 8BO,hFBIRmq<A+P>*[PSK ?b4*w85G h(̄@EcLp(-iǂk KI'R!&  B128}ڕtXG*tBPu)-;J?N#n ~ wlm8 IV_׍DJn0{tT%!7Bi*`#NuLDW *G-w'M)Gu5t$#M^\=yDy T23%Eߤ i U#)e5@EmhӕuLYq%Z鯺 #6jUclO+B9ͨGn)H@_M=wy܅n< |a҂cEoCK0CMF9AΣ{wB-0n.o Y:eC"'kwk+0tnEۣf=V aNt,]Z'*_}eVINeE: ^׀ێ'JS4Y (ik19o "T{yDEKVR>\4(8hLljKDO\٠pT92pxQ8 XU;ddH[׫H޹^9 r)I쓁@f}/Ȭ28h~ IX@P<˚ LH*IHPxOJg|,ϊ!-!G(D[N/Kܦ\~TaS׬%6*R8*zD4%"!;OނCnwIFx)#GuJpJ;&tsG5A;"ʃݔKx,='$R,0B#891L\i H;:P: i“{ 5cg! R;;j C-PnL<'nNB$vMxa*ב_kX=Ń LJ#DMI PS6?V͏O`!\X 9pRk;ŁzMQ}4Q(S( )%_'T95G  TڞȔ,uYGric>* qD-h(6nU[chuRɁަCUdKFIʭ@ajc5G@:ߵGjb1<2PcSa)u/}` 껌"| _PlcW9n;^t|y˫xŠd1P.I$S񺔘1nWB$F j+&AS& I !:cJ0:Q'Y%)T1L%M >HA"Ba) g+u,;.U`($t'I$()I$RIRI$I$(I$Ұ%ZF ^JED)XQ&;(ĩ+GuRsaIR"9FpTJqhJ%H)D@t _Eagu"0Au6p+bUQ"KO*d̅&j -~ 9 Dc0o*i$Q8 >)@S‘% )IY|%E?G8pi(n)RIY86%ce*$J[!<"9 Bč)tHN~Rt O]O>'p=Je_zВI( Ϊؤ&Nv4ZwQRRtԄ<)puC>ҙ>I[$ T)!-fI'I4MBI$I?dI2xH$RI$R-Z珚q"ZР`)MRXTDŽJa8)XR)!D)o)I4ju"|5 R k4Xنm>+7_쩄vpAO :I$EDTI:,p5[W7|Yv[=UȬ}T-un3[$ce]5'ͥ9&vﰳ̪ms@2tY_X ii] G?WsxLOf~PїL{tIB໔6Zuhб[u93GWrP@"! &NRM=nfUTf?"%ZeAK<@@ntX3<9$zdvNpxOCBi*%EdgS"T][=ֈ|C|oIVvOCND q(A58bRfcdV%!Jg̛(VoTU,=m N_J6np&Z9Oo*5jT+K%0WNЧRz+Ye rpF ש%3ƥ@g0=8[8ZV /8%U>?Wߢ`RVKƎܬTy f4wGCF$J$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$K]?]'7/./v_=s$JI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I%段r_)'eIIE.vX~EϮvX~EI$vI$I$I$I%)$I$IJI$I$RI$.UYYoOd$Ko 9'y/3Fo+6)I$vI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$}l??+צ20P~W1?3| {߅"!,TIXtI/I%>I$I$$I$I)I$I$JRI$!hftҐI$2tКI$!] ֘#~[ >h*&tVk[/GlriZ`a j !XFS%HF!:ͼ_;:.Yadr%DeX:lF s!X[,ήۘx+'#*$K-1b.wGgRpЫ Sĕ\|PPƎPK+X5 7f;>P$G)&)ISvpRb51[BxP9Ս ]ܦR*<)LREJHL g@fW^K'鏂aqL.2I& rI)I$JUMen:ca*S!DpJr$) J?FU%,MeUᗒla1IH,TxNS.h6XM EnU39T7/?TVᮉ&Y(x88x){mvi6ٌ|S:UKx:$puQtm!a3 vMGoR`tjX|C ^hZ{x*MPsvͧTT쇵}V‹1=FuEm<(|vR ;Raw&} Z\`{;Jd))#GHܦ9*m)1 .7:)r!+#Lt&>jK  thTUs]oqPE+n@ '&Q[Uy[TDhT];{#RRI+=aX~($-GU8&B.SW%PvZ#3P\ >{ ZD{%ĮZNT\pڌeK%9giW]gvD%Ϋ  : Jq8v7\A%׏4x,u λ|P%8Ru/ Q]Y3xB>42d' 1#i7EsD)2 L"POn$ns'-qSܜ9@DIE5";\|!LQJq%[fcBuE7N;XMPõ-ЈS /sD'Y}F7!zAڞTNO8r fÎN")"JID$]!/ʒ)&N (%1SQ EBðnYXv}"+VIp\+@<%ZI$&N)I$I"RI$E I-C1G|A j? 2wrӂ'r*T0N(R"I%!L(N ]2r ޠ=iVgQ>C?4ڠM)H6I$IIJI$I.RIJI$I$%)$D Fg#Yu M!L4Ldddr[SpJS%* % @Jby;>c%ٍCUnf䜺D՘N`&o ];'QӇgeGpvjҥN!J>|\H<2P?IHTdJe䠵~L?ZGo8?$I**I$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$%0ߚ|_%'g_3?a>?a$J']I$I$RI$I$I$I%)$I$IJI$VzgUegK1?ETI/Wet /[GX|/lQ#S'I$I$$I$I)I$I$JRI$b֭rXJiHRd)(I$㐶ǰ15Xliq -M)M J%Guu-XkYE³ɇ^UZ,+)$ꢔI&N d脩$ZBӝ|;uX8QX 5Wv+ANWBE gbe; C! W~%BT,h O/ñqEVE*BƔ*-ihT^V#<3lf)% T$ʊ3u OM$賙5tW!M?Qʵ'ې}y9 aDb} TH,B5I;)s+[)$RIJJRI$%Ck$Oc8RQ$.lȁɹRpQH{O JQB2xL 4!HPsKew &>+O0\It$)I$u:)twRb2a )JZ)|T6d('~2DHL|R(dNHx @"JY93UitKp][۱V9)cĤB澳 wn{;?LսC>UӅ"UpS!>aDZTֶA|;_Q)CTRnxÑSWӬW{p9D90*zcʚ.`T]*PUl9(%!O@,8&O 0D R0{s]+coJbUaj:l NWYXrw\1yt^i8B"R8 ,wMQaP՗Tnq?n}f%^Bߊ4Y-'D:6xiJRzDҸ5FR~+Τ)h xGjBvd$.Ո#{`!.py;[> LDRƠF}:fZݶ?cJ')hM!$Ty5ĴwMf O8cBiS*aHD c`qX] tM !lD-!ZaKt*2R>Dp[:xsgD)oI!k$:hvF*90&NeTZୗ(o=IU]Q;MuT,{N.x!f] F„+/'WHN G(. =5 FC'nGcj'T Ⱖ/KzYaywLec!*m}v) ԅD6P%ڌϬ5@ 9R^U3c{(8Bd(4L z5KH;C (+Dǭݓđ:{f!rQ[kPܥZvO )qpYXV)%QuOo!8C|6;& xIk8p%)JyZ纆G$?" R,נ~*lGD s@=B 3#PzbAPEM_F*Mk2FϒNh,4o0W ,wsgOKRY,7~:FeBNv:Cbl4rҙ/f&^Jú#n=rqʸ4(6aVh/%S& r}(yK` 'BtQ()yN5Q @h%HVݿDK5%d|WhX U)&X2t$$INJRI$tȩI$=.j? ٮy)FbU02py'Y:dB ʟ!F | d 3FVgPG?"7 4IsLLI$I$I2E:dI:dIJI$1.?l7VvCDw :qRlRI$S򒔒Iu='I$=cZPRA 3a@c3«s_OrݘN'NS*I'$I$2pI$G⠧Np&w ;yQh) vQ7P3xNMJ 5(td5*6vRj*>{G`Cbb#^KeɘNT5Rs0Nf׸w!P3bSRƭW aF.e) G԰8ÎSLcXdvR o@VeeTuZ0+0ʃ01ȿsp* 74䀍f‚$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$]V5]V5/7C/O0n_I9Y]_zI$GI$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$K?O]jS_UO//_C|]՟]՟̒I%$I$I)I$I$JRI$I$I$I$$I+=3]??ʟɇ~*I$2߂:-#>sӗO(_vgΌVl)S$I*%$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I/20P~WM^e`[? c?g+ DCDX$)$_I%>I$I$$I$I)I$I$JRI$W9 >kmm.V0r8<'`ARUN:d-[zk9nTdr?buYtU ? !9:wj4$6) TPxC] )˂Jr%0)L|1))]Ӧ)U+q\Gϓ ܩiTg[QI-TRI$C2tTIitӡW,ޘB *;Fw9ZRIN)2G);(;.Bg  (E4~KBXɫ!ML2jTI$ " 膐OסPY-:J:p{C,Dl| sq^b0wQ*%b;(E4! ?їM'YHX0ϤЫӜ[U~#-8H\_ N[" w[cA_ag( $xw}ФShJT. <% P%R⢹F0'L)'LTI$LyNj@nL> hXZ Yʇ)@NLGrI4$p$()H,Π=c릂< #PUj0lYuf9ned;+H):m Kge5E^3iUOuz:OvFݍv'PI/P:: Z!T)`;J@mQ%dJ09!>ҫJ$-nцihWHh Y$JrR&%HIDkŐndT-*LPS@:w=iMOtUJa.,`87%2UJ*ےR==_ V⨵Јb]Ә[zxq@uJߨr4&e8DZ/.wHZN9B}SIҀ7U&ڍ)=}kO_w&>+9:{Aksy :}w*.ǮxȪϢ Gd#:Mf@Y@WZ~@OjJSmqXGoS“!m"TkͦZ(eVܞBToDi dZ<J7AZ(+.Mpery R\9&ʗ؅po!-$*ar\j70`1Th/XǏgX~H6T7w)aN۬i 핇oXT#8lXgoCEώ-g >J]mgVZ@t_.'RKOr6.?%ڒ7QM&BUeܷJo\ }(pޙITOkUcoM8w%6ַd{@g$gK$B;z`tS**e==ʵWH/0ˣnF#3AuېJ@8! N\VW&1)` (pQNtiQ[\SUVe*^G nPW˸Gu](}S !Bg{jKr5<*o5T?hF&PMfJGhU@o)ӄ"̽7-xtgݨʃKcbvDJڕOM:-qV09q0CkjSC֫5 cYQl$Z Z ^]Y:HV,.X]CTE:+2pg WXǂ}$ JJF4ƍuhʯ!]gk$ehQ=>JeM*Ac$A?uRftA{cj_ U]ڢA]5T׫VF[Z":(zp)hQ9 p0xVƅ5؛DU1i0B p*ӚDi;sD#կega&;KFsk]v3R4[\'pg݌G^ [+Z.0W-!)4y|ha!?V#5A A%(9LVLiy.>@v Jxa!cƫ!jW\)T ٯ(1ʝyuX%<(Ou95Gd4?4)NyIMs\!tdx`)ːSCpQv1Q(øN6mn5 zji5DsA:h* n!"ji`6{'v[ oi+w%7[D- jԔm{hg V颉y AO9rKu*% TM`80H!!'{ Y"RR2:x@(RߵH#,!1k;VjS(SxUţCԭ/i "o)XBO jFZ z gLaQҤ.UKzi f<ֻ.׸Qu#^-D Qji2[ WFh [%[v@Y%"HD! m*8Qv3&`S!&BuIm+ Ew\xLn(r'a;P݌W+T͓iw N뵝 UuL{4&.FaVG+4㐛Qh'i숙췃}:8B[)A+2cX`ria.`Z|BtK'QzH:.Wf80% ɀ-&fe)MS(Xѵ-31`]ӃQ)!` 8)Q\&24 @);2ƞP d%1SI]Iަ{DS{8%YGނ*KMI1_Q xK(ޤ"фޙGIl;. J`驻)@l)mI+mجw-g)|3(ī ^X-SYCwM ~J)!or^zkz}#e$p!SUIg! &$n) &<|O8!~(xRrzH\dt]WCcȽڸ?`>!y{`v*B1Z~d|A Iךhs UȲJG05x,޼u\no]^9Y?F>W]x\'#m˻!g_zaRt@o= (D p o'aP3aV\>V'%ʚ>;VJ6%R=j.Vw8Gx$&w*P~qK[y9)fp=3B)SN?dsGXxEGPRh!16<[4tUQ…FsӗO(_vgΌVl)S$I*%$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I/20P~WM^e`[? c?g+ DCDX$)$_I%>I$I$$I$I)I$I$JRI$zs$.)v=۱k-?HU|١*ҫptMN j#B PX:+3"c YOQ>V_I#8ze}\#Sh'ReLno3V%2f\ExQ4nCNNYc8*>)OX&e1`+_$eb9Yv{6 YT}|x@[Dj $ M$gbBG!S1#p( x*R(I5KJK>BA0)2Mҫ^|Xo)B S}.o!FQT8kUpud]^3qL T=%Dd= HL%"JQN' ?vW~U:^sKsdzO%fd$TZT"}bbJ.*Ɓ$-\ў~Q/LB%!y9TqdrtBxVxAb%0e!XR1MQ`Z*Ʉ3<# XaVGNүUEeJ"CdT!TT{q*iQk\5?V 0 h MsJE:I NBAIe8%2" SR:蘤-j' we 9Mr*MrTEj1lMr}1aSAQ+PDFL귬oXJiB-fop B⨗M— \a NSAHT|IYA=$;h5JU\TK*Jy-0QEk{'4'`=z#m)Y AWYZ'Y܏U{*ᴉTCC29Z'6r2D䟈AM] #r[ Or>SKj4p>-ajrWX1'X*w BbGYƿG[$rBy%0sШ} PB8T)qAphʉf'Sz}RPT i$Y+$N zT]͇S}jz[R[v…M` /d])hQsJn[ 颋N+DeNj㲦NOC. *Μ+ZC}ʉD)@5FCL7E S ;7R/E QO0h`8tS hI*eq(^ߊa"ײ Bb++isY$!>9<[ªj'\SFM!vXcvU`L(~~q"e|jϳ%I`N鶕ٖv &]F7G3s$!##onxRøL?Rcا|gES -#^Qm~LyjL:Ȁwi jTr)k dr3]ĉLU!֩0Lh@k&Ktq'<7AVU>J rYC`Y 킱r s%}V^K6)Á¢'NU#Ss4 05<9tz4 0{v]eS9-4H jᳶ8U:w .G^S=YnlǶ,kZPOSMγ <+hW[{-BtN !ƽܐSZʤB~<|(op(*2ӦHqC۔Q@:wU &R *AXSO#EZ#DS;u)UxN[W59E9bOR,#TlBoۣ, BkdC`QP({ B3sﯺq=,YW8})8dۧ^+}biUX Bv!;- yJ3 (>*ɭC_2 +iص ug=X 68Drm;UڬٕW-(6`Ҟ2DXqtz,Zu,E'/o!1r d`(9f]/2>&)ӂ@!9GӸ;L*2PR >|#ldOH8)E([HC} vxĨ"Rbl%w2ڣ#D]ࠦ7|cψKnsC)9SJAuY#E~ZC'ooTwDk T)'؝U[jsLD+-kNP,f]!DxPs7j Z敩 tEcrEz9l Bp7JoT54^%;w#|i'j4Opr(G)`DJHUҝx2%vĒP{!ݸk&ʜi!XǸ@ J!%2h*.P4MrPVmih:)tRSL`QZ($zfLd$VjrD)V>K'+ҝEAl1:T,;>QOo?W'?xN'H2bI'2IBJRt& ' RRI$`Xڣ_/%JЫ*8MHh_hMLjgTKyQ"mU8Q)Rਧ ki@ӺgJdK2y}ŭ:(.>OP e&DdbANX v[oQ)r:I$I$$I$I)I$I$JRI$:DMtV8_i%|7RwV2'D8 r%o!d*+3 rB_1͐E1NfA`-l$II)IJI$}X> -Mkj_X 9(6rPC]Eז8Kp @RNaE^Κ R<mU'2pb) PO+/P~i5=|?Ts#\qQZ%/)W zT-y1LpV 2LX oIiM܆?؂BLTKYM+Ks"L·⌃@FQH$BJI$I$I$' Sڱ]]^x|J+%IJPcBJSBg')MSeAW)',\,( ` J礏5D)Rei'LMJI$$AJI$ ¹j`bqe(Bb$Z! KJQ)JE2Pk Q % qa ?YwXC'gT#GHj Nk. O'c&9FaL"!SjJ?b$&a)V7QYcy2Xq )Q+=GBnI@X4^CtH %DjQʯٿJkeWꅧ]McEc~ B*,-sTCZ@΅s6H>JuNrVʥ7w <=Zha0ɬZ5A$~c8 s9[bT67Oɉ4teZAQ!MBPSȷA$tUH<]>х0e(F,iKBS? TM`NAo ;u1`OC}5A( Dk))M&Rp l J\*!*axKpe8DBJZD%20%JR? LL'"TSF$!&NTÐwBrJ`ZSmG8rrxM5G*d &QT¬nQ6 j'U1]K 9.'M7lmD\ORr\!NOLiXUSBTSS(7N aT%*-|5j* 4V4E34@v{{-Bxw)q6j4?|U򫳂aDž^WW%Vs+~ _U!V|V40a yc+6pKO>+K:[;{[cuUЍ[UCGkC*DC)0xLԒ{G}IC-0Yk]%"yEPw[u*t5T?I܎G( jmܓNF#$ '倡~((lXϥGV[L(.r;ޛ@Rid 6)nA Tt$#3Y_!/D> Wu:ET]Y<Щ;GemZfS*A@S:MK1UuZfT R# r&NJ`i! 8vlz0 dfڕoM:&}w+YQ*[BԊmSSl .կ$XKa)D)R Jc눒C 1ۺ%E%8EEID·S%,QQ J/dx(:B!9"D&2gtݥ^Kv$UODrg4>{r=: W[i*O~Lgz=X*!YoQ؇d$|io)-/I8{Z>>pW#Uj{cd'E}0P]Ӟ8O"zR nX`IUK\ıo z1#xNԩvKpN'ܝkiTx0KOg!p R4Q <5Gs4Q-=œ*EHvQ}La %Oy% JRC\cLi`x"6eMGD SJklψ(5;c7+Q5$X%1m~sH@}CVQ tQШzܩJ[<" ="jT#AH6$'nѠQuDRMn*4{(\;cN(O-H֗ D; XG%q&l%d'xNX~ i2~+Fq$NCbódpw +ԀGyGIX\4.^D&hyMYٍuHH%)T\4R&SSNP ADEhv(k63i'LS$JIRI$RLtĦ8)I$ԭV'c4jc!j,z;WU2\%MJIT O $a? PIJN?)@pce8PQ(+ϦYy'Qo IN I$I(IJI$$LI'Z8h֏N*!R7RDBxT mTJH$ḮINR.R#ACb`)aT)$!V h,8bPN'U%a6z{p<+;H,QܖV ñ;!70w*$pJBI>&!tI2.7?HJQ J/%jŸQ#U0cEfPpM:$SIDrr)N'&읺r1H@L7%)(N!1R,ަu @賺!QDv+Eg|5RI$2$I<)I$Id%)$LBbjI)-C,P~Z? {UUYlg9I.+ec4킑NYU|eX WR;P v 4J@ji~WlϢ/3xX+ EѨ9,rT+-9nC+= V}%/ F I\Lng>H;|Ͱ4v𹿩b]!G?F@r3翝MvLj|(l~SiJЀwx6 )Υ0Hr-h?F> 5O6Qe#&JԦheHx\ G5 `t\râv~@2JmV3Q*("<̄"I0HSL" .|XIS{E:Qv)k+el X֎@i_;+bݫwDRPdV0,ckJJBHG,v$nIV{ T$> YN|Ӊ2J/P~R0)yp7j5J@OXq$X,II$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$Iz?`Uk\g`UkR4?w;eq$ITqTI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$/W֮K`E?5[?);?u9ȥ}Ynȹ}Ynȼ$Q:I$I$I$I$$I$I)I$I$JRI$?ʫ+=3]?xz,⤒Iz-#a2߂:?9dҏ%ff92I$RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$/z_[?3{zorD4EI+I%I%>I$I$$I$I)I$I$JRI$~ym}ZmiDxA#!$.ʋJr&VLc䳺|=E,spTqP tz!2)\I$I$I%+cPX_ZY m U%2p[I/dA I$cf!naXn{B_xL0*´$EgtI2p$ %I$ÐvP;}vylY L\y};ۨQJAB`K)L8^Rs [c sRhIW^niWmnڂי[ƅjb H_` P(<(A U#NZF*X𐔡dEQ]CީfCA&?EBࢨ4QI$E.RI$$Z8d,ZuQ> BRK< TP)҄R(H$+>RYf:9(I$U)$NII*I$1 { `fƭχ넲ck#hK<~k:W :!iU җWl<.w+1\YG':'b`Ric؈FSEv2n5-~Q#GV)&aSRЩ[i.|+u_ZXu!nbm.U qeiU1+ޟe| @5H-X5IN&z16@P|\5iq5bUv +QTi)JzRX5ed53 ]T q({P\Q:D&(gTw>e9EJ cZHp(RRYvT5a<0$")bЗTt%+xQkgdH0tKk\)iQuKx'TE%od~䔭Аrhrg2Bo 1ʐRR?AxQ;dD,NJL䨆F{NwBJLl!L:SIL a8oJJ{攤S!w*R2d7}+!)«m STELl[B^=¦ApZ;!6sSg8y(p8#tǦJʞ;rA+N5Uch] bbVuLYS \*yXqosnmGGH[FeU?ߛL9DnGdANe][",k?KQ,WgUCuNrRSh:S;B @6C`A̩Dm_0<0) J}NH("aO0rrQE46𝻿4e T'Va=P' i;uX3^UY*/?Bv p2Ɍt'bC0Lͫ7tyP50p,8;>kzw$.:Dc8qX3Zĭݐ_~fa!׀1`irZYϥΒӺs'HXqtz-&J&gEW_i2u ]g t'C o!?ShHY@3wpF%:~ D VG:|R#폢T^2SQ %i@I׏G0KDP )GDƪgM69O)*ޛ P9*˚O)O$hwA"V><ʳEl>ŀ4ŚBvɔ&ۡKzCe1&j֐a7 @(8yz6\6~%o]`O/V!l,z[thygH'&FzZLe9>wJ%(Z,ROH.e/)Lx,;4qYArsm7t2xNSIGJ!"I$~4JRI$r'`,Vwj/痒JUXԩ)R qz1QH)!2%%T%*.RJ$'1_R&uL/)n.WeaW)y'Qo IDvK I$IJ*RI$$I)I$KKf,W~HHO ]a8 +db2thK✥\O)!%):dv.GMS& 6me.{Ώ5ʚI$ZI$I%)$H$dI:p$$KW~XW?.Y#3KNJ}x<+4:dRui쥬 bJ%<ܠhixLD( gxKJuYx ݊1<+gNcfB<2@ЦNOpާyId8%HM%ޠáEfegN4SF%h%Cd]?KыUi^ehi^cߥdrlG4+ZKZ> [$5itv[y&땶\0ҽM;esZL4D0-ONsӗO(_vgΌVl)S$I*%$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I/20P~WM^e`[? c?g+ DCDX$)$_I%>I$I$$I$I)I$I$JRI$^[aQX?%dj%V}u6^w}RQh;%P"׺MwKH*>yN|XjbPE2I#dKPn(j5֑Tj*-eHjGBA'$M)IJI$BKJ~oY!aZ!a|P~걝t!Z m(JI$bI$)$RIJI$B,L#86 _V®ByJ JR:$3Jg$Ω :ԄJ9NiytrQz> ›.{>Vlo:g.?E6Vŀ$YAIZIJIG騖d-*Zh{*ݘlwhLLzʮQT€suyv3* aJ)2H^) Uu'TxQQINJh!jrFœ;8B(pSiRU,)M‘%/Ir Qի1j5 g,]YUztJ$IӦJRJ'I1#g`ۤ[ 7A;,ULM/t*@{Lx.V,sMtWtMZY4|4Mj]Z\~_X/.CTʄ0mLTME~-E%܆@I f֙5[XL"7[gXʮ)RnbVD$j+ܡac4 tZAXeVܭ yQZ4*$-YD(Fjݪ!!,hBtBnV8Ms[ >~Q›o)jsS. :6M Uv'4BHJg!Sr;^pec]e?D)W. m%ާk>VvUd҈kBp*o$ʟ0>8))DJlQ7kġ@S9 SsCHJiILZKD$H)(Dq%D<6%0qRڟPe"IHrJ[q' BjE#2ILK ˆl1j'pP5&B+S% #"eL *L xQ-G![aMI,J[\S;dKi()Q2*b)D%QKqILa" rpCPSTM!OJ )ƉRzj>wLQ) ϊR) i% #*O)PKI w!iЮA>R;7UM.Ki}@OV@YSxcXH}* 6R5P!qCUٷW> HvD3a]%=_aTwRnAK]珤?#,hDYӫ:@k}}_2SG*]l4Ku\ZOl|O, Qf;zs|TJM<}cboGd>tǵGtHdq5]]nk?`78bvޤ-wH}j=B{FVtLqaƞ3e!hS0Rő`2c>!ʭbZDr S+uJkm*]D!X{g nujt's'$xN帤 ' hRqm}Zmu[5&eFz-IR;o*|p>yW Du$j`9eCn3: PSk|S4WAfWI BL~ H01W$v\7kdhkO~D$Ryݡj>6Apgw ճuzO}tNh0m,c"dw]W߬ iOPYjew.-Y0 qD"6B&N+ EF[߳I1Tr17jyD- \xS#jrəl݉nUա-TDSl>*BMZ,4Sk(R$RisxMy -uۈ)LIILD1dNFEΨ)(DC^iƊL`B7 `=ԽDnO$c@hiFr2;ge!A OCLr*@%};N'cZӻ@ir69&nj y*i(PJ] PSLYcuާ{U0QS~!S4-" )Vi5[hh7 x+RXԓo@-#R0$6Sn]՝ *[zE SAHg@ŌZzG ̦p VS+:6u{DSIHMSBa1iV!#A'C8NS`T[ĭS4 hP6㖼p9ԭ[0jX kDpex}9Q<') i\']EVWLmFS D{!@40ԎT5葽>Ԙ٠)L! B0/L9;*M)IHJO4r 'Rr: j%M6U)*ŒaVv nثiCӊ'j'Ehu;+=nHc{ؖ< +U׫ ձ>.qՎnGV a#ZQ8ջ3wXpv/b~p82%Lg]^X-j? RԃPTKitiAWð S?JAVV'cg vZVrp#|_+Tࡺ2o(mhBX2B%>?QZƲ*h 6&UkJn]滒;5 \4Gb`)zJ~eW sDǒt-h'ꥒF*U ,*m'ݖ7 ==q a?w*0oF^Υ F6O-_X`d@Z."hP: JD9L,tÄv} ,ҳYpZWZ\;EEE=Șޥm>iADl3KO-WW\&U; CyCq)Zh nU\ ١# 0l%&W8!2SKA$Gf6r/U*5j\%/,9IF"f]}*,ݠB-E lY_D,3SyQ1ړ-ҊVg~, GWXJ d:bYc)H_ED6^,If,]$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$q7f\ه. ?Kw.ya~jD(0/W"Y!br/4άVç_6r^I$I$$I$I)I$I$JRI$6! JRI$>)%dI2%, ףKHytw )-")>D꺡d-W)DX;?r? JsD%¡gMcnjc)Yq 7 ÝTz*X¼܊Ô\̫+ࡏ?8%q,X|AVR-nZ,Ub+ppɰ"G5pۙ]>+;RLOn+M*Ь3$Z$II2JRI$n4i0dJaY,e 䕦?OI ;R邥GA[ֲⳖ.?MXUd$)I$IG*RI$Z Y?t_d2Q_ l"vQ+TE9Pu@ +#VHLxq*>BEgw+::%Iddg8eF5)zJhan6?P<G/oMG$1yH\9PB{Jaba7Y N{ [TcydÏ/}Qa>V6{" - 2I2t$TI)7IlT`+cg `B:Cfn15?FFje ՚ 09]W_5u<[SI nS~9oo!OZӆ J*bkRi8S 'ʕυf PzuctFvBct.zab!_NZ̬)?UQ F)R5hQ}`G#T%p)CO )p#\jkp)npQ8hLOU ) e"xR؟bԅ)zF ƅAJa%,` 4@2%wAv%);p)@V=E?IN)q6z[( b##+ ͭ걬;AR-p0ZS +VIk)5*G.QL?Jw6RSu` X!\*D%)*ILʌ%)4'HoJRCԠ&R-&g8))@SM%)BJPh &Yn!ܨd2 EǺ46gNR!&G{NTSJqDRSn+%?R B-TްLqLhJd觻I JgS9jAԹR4!8WY Id,/0Zt&Uhlۏ=Խ)!ˍ 58b)nТLjl&/ D())TR Q6b%je BvCG*"PIOaNڋRd=@]{[P х?$*<*lyuAԩ5*Hop*d_!<-BVhGPrx 2*MkB؅dD+,{wǚ$|8 <&IkDU{8)cPwLֻM#]rJتZ4o!\ =lntU_Xġ\dk[P֟hwGdv۵ q $ [`Ѕocݬ;SZB0Nn%jR $:8{DBp[X-mÏVMx#59/@w@#A ͶG*6HSƉ+5تy#VFIJwQr2p#c-h|+aq2pwtY2j4d^*lA䳭/>؃7y>zOPeClkʓѺ3)7 @k"6D&kH:hSL–$2X˻T;<ʏ+*mv Ws1*ʈ͈T؀=̖SaϢT2AVA4@;Od)rg0; + ʪgiJ$k)C0ʦ@]\7h?')<"TZ{)ģĪqCw'Xvٳ;W*R" O v[^ {DvOʝLM>&lS2ȕ\f98HRp(L ZRV@>Jmhj9ڡN5d M>(UdG8ZJR-J%1HNnc% $9O&vHGHȍ4H')Br20IFl '4BpT~ Tڐm@I'O2-L:""(z ϯv*)oH:Te+SQJj>'U-oQ4>d3N@?G!FtV+z \BG eۨTSLjN*R-=BwVXU65?:ޓvQEm7Sx>+.q%T}|r )liBɩGcSnEBTsSRDJ)58R*]gHp KrFmMAꓱ1]^+2}B[@D*pم-gV"nOPNAFNW#T}%jXǟq PR sZH*76N0e>59DW䜶KJRSf!_qʉ]\(xM z'<#pO8ʪZ=O@OaKb@CgtϵFHOTNBun|ZݝMH(Nʮfc,v-&šJz!uF 6*heoR5SmoRSGF%]I MYE$\ 4I$铤$I%)$I$IRI$k}5 |8^pR * Vpm+f *%:tN8L%,0TA ʒ'2H0Qt%&蜉Hw?Jڸұ c|WQ-3d(I8ԒI% .SA"$Jtr(>:9pqaͲ~m|WdW7_g iW`(ⱡ<>Zt+]2fI59B~}bh:GJ'fl0A?mRN;g+Rf U԰y` S࡚}Y@p?Iw[e3BE&T}0Yڼ+ )!̟G 9Cmp&ia`%b EړI8J'g[>j;Ne3>I$I$$I$I)I$I$JRI$v!2A%)$[M2*Ճ$MЄfFNn`>H b#CXS yC($2SOn2d.T:K7T~ / [= TyPj'Y)JIrōI2RPI'[lQ+*!kt,s1mH62 2v5Z%heCc!V!ı[F8?З1L,i -cE&Z np\4! WÅ/+\0xxTZ6P,07j sU[( ӌ-)Gn Q-OꔤBc䊖H' k+mekYXs1`*AYJRL$I0L%)$VpBۢ1h[-+iWՔlGw$)M)O޴RPyLJy HY<&ԧ*hXmaXsw+aUH+II8TI.RI"I#`ZNŁmW[X gp@G(Bv?U>J j|)RG(ñj?cLQZ{!`(@Xf7yecy :(!/QEâio@4FnU\S6,3o# x+\.:qp=6kʨ\B߲W9uX.L\iג5iy/Ov1-d( VT%]LS֒- #&}]O 8Re= H7 sʃ328mRSMwc颃 hlz¦\=M%Ji8H((C*B&!cNXxQ4:2>*M#pPऄT\A!#M [6X JoP8"%tR$Rr[#U*2 =xBl5IM2x NwCͦVdj>hmj+(iʭzز&J~Hd?lN*ͪJp9 =,=+ddw:CO P Z4 #]Uc7$0uqF9ЖPú8J`{ LlVtCA@VCO2Nr;ګLpiPhE3etD)]*\yy!=F9@fTDh`&R?rj"@L쇹8r@*HBusW]XJU D T8$Fǃ 55F.Kr\Z,NJ)$xC%%5\HR`[ҫJ#l!罏n ۫8F*FB!AGNJaOY}-Uzpvmg &SnJo@ܪ$)o<>QL'%;Rj9Q0,e tP耆j!-T}7gtjS)*!$A %vhCUST:*[ܣƉy%jj:phC|TN4SJJ6N_G \{D%!-`SCkRmhUc!xRژ& vMGp!"nĢlJ!AjYQ)q#\J.x/>'NzHv^?UTXcUA4')jӦN'o)CFRct vtFA]f?y2LyI)6AJRxEI10NrGd)&S BINw?VHmd𪷕i(XI$7)dN$4B*RIJCT [6X{y1O 1:.TL2Vqmrb0< wBHy jHI nU2RIJSOު*eRלWfitY]Cşq+H2*`n "& +:׋m$XDnkXL)Lq"bbҊ MOL>,:lYvX7ؓ_Ȯ/{ZxWn H0kjHp@8P@y\4 _rm;6|5ZRKrY>W#֬2#QɳӯNPs]g 2Ώ3Z O 8Gb6Fڟ+p? LvSNS[G-Nlv|=^!#GY,QLxRQw٧@fX J)o }*%R<U #\p H:Tn!rTY6vJ2CY'(ؑ:B5'I|օGJ]*SI$I$$I$I)I$I$JRI$I$I-lo( IcldX~ 4Ыg`'U%& *>沓BvZA*& @Nok 0}8L|U&P-ܡ%8&JTY)I$ΘUs5h_,MeTEᗒʓ`n 1Nt)2I$2I)I$uLVbB~k-x2CDCHZiGE%I9H$ )A9) -_ bX1y3Pg - M:,NQҒ&+u93~Y+0sGVXQ5x"m˭0VQ$9[,h8RO&ZDUz7n tXk*)9Ӌ opH[VlĠ9 ?01RTJ>d,*<|V}xGe# 6SNQLJy1H" )JI)S $BHYXVzV X?guw ®U:`I$I2HRI$amd,*<-ʵn|0HAr:% !0Zb t2rS$`!$deyZ+'4E'[_4S귾3[ԟr羯 !G}=qy0WoP֟p;UuSC]BVe٨вDTAӟ5ztERƪÌN l1# J tpqXՖQ @J @sұNq*o;+̦cբ]a9rA )EV5Nj+ > ^@T*SB@D}j~+L F;YAl)ZWR, ]JraA!; *NHW͍vJ6IC*Q+%:6]YP'Gv:$$ZXt"dŝ@$&%ĂYOwU>MgVZ{+e%4IHj˂#J@8r\[L,9 niP '5 ; -DQ,p(ޫmdDRR ki‹RhEj*0ਊ3ޘ?AɈ(UUMԎ ųʯH%IjN5P~4} hl;ݕ`S)Ym N̼d-JgTȎcB~ "Z:>W?JB:@uUCp-r's YC^uo-iGaA`ПdRj!7ت<$%+_}Z4Hu\rYrs{`5DH)߄V-]mu΅U.O(㲏ٞ;#itS*43j:n nR58vQ,()7P2kw b֐p PRR}4p )\ tJnH'R i)E(L-Z JS#tᲜ4LQ@jgZ`p B9nwe۔3nʌ)+%@&nywOcu$*ߤq'SLlΉBηRw}aAU`ʺ 9En;9J1GTXsE$iiCQ%8ugQPLFq 4q/w|αMsA* Z R<+mrNkJvDSt³2(4k1 Aua@GPs Dd )#^MtU)?KFү Md\F4JEB)û.i:hBtP/MpFGsujw=jShC([) D$+F[NA mO2e B2B*Ϧu*>;l=N KZΠ6c:+œQ<](s$ jWD/@j9<ЍaL2ڜ,Dj==PpNhOM ׮ǹr4hУ;ecS)M2 ʅU!Y:O&~;;SJ`p$mx_!GuzD7%#YH4HPviFyyP{4L0!?NB*ZXC*`kM}A rR:p阙Y757t@%ی,:X 7yTRJ!fsjk>coDJXtL)̢ &<-#`ET}*xuA䨔PBJP ̩R61Mr JdcULTBS)*.ln?a0VLVO>X̚udp7B! R+b$dHhI'M 4JRI$p8(I$Ѕas Y# Ԧ%#L|SeFR'HLJ'Q ;$")hN<J"Hp!dVwĿEg@UN\$I$LI'I1NI&JO))I$>"kV^YEP%M(š1jJx½pn!5D!7 NK`Sf;:·"*9rb^S*)N|]5iZjWmp{[SBXG=`{6@7k.٬ i-fVtFwXÈV#iAO`BhDIm5@bz!`X#LQ!([)z|O߈'0IOjmiĪ]DCBNnCZ5 >cÓ\A MKjCʦ9ðvQ80:dxO!f1iR&J)tI$I%)$NV6[xai|/ԍԫU\QƇE0I Lв)'BQ R;' )tHD(~()DHvMӂa10SbaXmdѕ>+V`ɇTdr:b,5I$\TQzJY:I)p] @bq~]I^H9Afpx\G[Ũ]Ma5e^\{cP`ML+T*90=5ItT:Jl⫸2kf^{]Sv|[2{[oSL4:Yp!f 4TH*a=6Cv0,JVH%.3 pBkl*8~*^fe#Ԓ +VF nN`=v 1Rj~VѤKJOH]dSj5kghVuF*3K%VDuՙ  IO $gzl͡,OdvLB$Fk* IDBdu VȞ^R=m17h'5Dž*iY2˻韊XY:I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$Kѱo~DT,_U''Qʂ$I*KI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$BȺEpXEؘ>_GJAH .a$R$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$_I%>I$I$$I$I)I$I$JRI$I$I.?v0f,OnWIʛ +y@yGƩAXQrx1S[Jd- [|m:8 u1Ib}.qرE5gl> <і3+tf΂Bo{x*>(?N?kQ-*%-PՅfW^uFwRʗ/9.)}RʑD଺T APpԦD}/O`FQ''!4 ]$Oé O] f Ẕ,ME-v)Er 1IJ$)]ⱳXVӸYD{O'dQQh**ԩ$@)IJI$eథm-ode ?t 9FHJ2SpAԴ,$Bl "LLv#sDWQul,Kjg"_0XMd[Bv.V[ԯVL#6+T8)N?bxGiVBߑ)[c(gV 25OŠа!aYoQatYc.B!8Lt.XO ! :E%I$A2~$$JU[jX@궱-$#^QHp'kNRIDLI2J'!TG,ωe躝\(J<marV싈=6"lC ჀsO xҟq Ťr* LDIM3ZjB^~VM˯U%Gۋ_Y'̭mJgOdp1Dz;_ʏZƚ~J@PnSOmR2xLSjAҊ I-D>X)(<& SS9aL4);RjYFKj![<;a@4ǝ!U~)ZH+[f+f@ T}SyBSjV7qNʻ2 yW%9k][5p[L}Ҩmw!;Äm BfmQ+w :SQ5B*l)k]Jq֧+%1+k=<EYr;EY8ZãT?5/ [=) m)|Ru8!NÕ`0[Ǥ׬ S^/FY D.y:kBvs'亖R9@qseOvZuyPwNq%vnh~Ѫ9#Y%EO :387+;fJ*)cʬ ^qk5 :qy*EZv^:kX> 1֍FfG !Hkbtֵ-ґo!I${B0C5MW0*ɓ+ X̥ssč'K VOH6|t &\Yv CΜ~5{&{#<0[KTH.R}k\ *U$~Njwh ]#U nE tE`.BHfEb!|B +d9i26hFWY,dSR}5ev 7_3-!a>=r"5ԡca; kZ&J5Oa$JdVldl!4ƝlOkD0ĂT@Yab" 䴝BʸCVո5KwP325 @<VѨY"@V*CEh\TdRp8*EݨP}- &~H@ z)|) BuFI}dC:"L>Jm!1ßQuC@}a򕪜K B|}24^*[|woBn*=R];MvCuMo$,0 AʶzΪ=b]%sF9S4*R[ƨp|%zU}nD^+s{©$蔕khMmB4k2˘gPpVuk!S%‰|X ,@Gj) ;<)p7UWReLn %:[ c<48T 5DBp1)64T5=‹FV2@<㢈)-5 &L)rT&Bm9p?D4؅NJ@2R%Ns5 C-`2 @x^rjȇXY 1 a:pP)˓)MPN0dӂ |IRR%g@8 XAS&!:xEۮsp$AAIǸD  ny)Ђ.Bk:1DAS옶S$f#ਐZ* Vr @\Jxwo- +>JI1$.UmaVnӂcC`'*Ljc9MZ*bA!W,,vDP&JTSukF%Х|Ɗ@)mYRjk;*l$IJJy 'Q* >JFz 8t( CAwu pø+mH'%WD.N8c7Un8kiJۺ%疰蹅'ynW"OٟQ^΂>Ln%`J*+m4@Bv g)'̃"Kx[@-pYI-t$ -2CSSe1@Ce&*VVf>sݯ+V[hJXJ t{OdkOu= ښI!G L&JN|;J\pi)D&~X}#[ ôd|Wlɺe*X(r2~V*IJ$B*RI$RJ)I$E uH*RI$g`F80#BHw%1HJI@ *z'LJtJMM)% Yz-'NNv<蒖<'L(3E*)$Pu) K ϤTTh\|cR$IHLBI$$IJI$LI'VDتo8Xx)Jo IH&*@eֈUE.Srʁ#Gs % \B~R îf iH6|uE[[JUtNGVjA!])\!䷨JyYG[%hi0B X_LqǑf=oE jrd(k -!ӏE1j4%n Ln:,q8\Hv@E- -kz(M*hex=4ޚ%Eʻz!MLwpiE6NRL0R3oneoJ@dWg(uuDK),N:u(<$Hآ\u`.b6*?^rs]5^WspeM [<Ʌ=rr|JC[q0k.. cֈ j-}zFk 9NHSBfcGncIŞN:T ֳ{%]|*8!~c~ɻ*nQ>v8YτPw]&|ӹTN%ʚokT3 ʖqՇbSM >fh-&YxAQxA1gF(aU9PR(Y”bHa 0TmqT 3zf8HW`Е7F%m~ǒ$7#Ew!M(YW\^WWy[䎥C IPXw* 2I$I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$EBiU_yr|)ʂI$I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$K+\_Z_7MsYI%+2I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%I%>I$I$$I$I)I$I$JRI$I$I-ϫF}F@W9iߤx]5] o~ ;{*DdSpb gTAYi!+1rȬ`Rbj¯!XHE2*I$82Hp|lj!G%au Xѐ4J`HNP[U]>ҵ"R-T>z 8B@!|r)Jó,O*Ua.hU{ y"@71@nmo(xv"q'Rb!9++x+PƠ4?}&??59ڢ硛%-ҥZ-Ȍ]QEPԉLJ} Z%( j0Z ԔZ q:=)0S+, 8…sĢ͢J*;Jk(#+S8jB' N6)'@T\BJ^Q&p ̡TQ[P(cG% Jb{9*d[k(!H74 SrAB>uKӸkKӄaiKU6,7PQ:NMqԔ (GtI(Z(RmcWpsjuLi%Dz1lpU9$*6\`!›r1Vq&QI)0$ 4T#I?)`VYUXgEB+.I?$M'Vwb WNh'4r}% ʛkXrS}S"O*@EkO({"1 YD[.5ou[&$䶐uȰzi2{(W\jwNt}?}l,͇۩S]W_:RQ'|@xόilqxWHHY} }AӅhڂXcIU]찴eqs.Yĭ~8x3ת=F Ӧ00T#Uk7Z4U2a{>*7UZĐ=2;Oeo\4 oV?A>ԋ)JHXIT>>J vXDBy">Hn)葬Ni[D0(.n e2(OIrt=#HYGLmBdL;&CU:vb[Lf1O)BM)Z݉: VU T|܄BaW4V7NUsAG'8U8ΥS~;cA(cm jע8?IH[ -RsZd)MRR" H0P1kԣ76Rk~TM`u-<)h%_YV׵g쟊FAԻʔJqftW~sFAELVwM tQ 6G$"3!n*] +{%跶%[кg]tG-:X3^Gp%WM=3JuɕMr$ީKI in##fz2!MŇt1Q$1РvZ8)4BhIP8CӉ%rAm)jI ո5YNQB\jjsHh>C)NKBSET$!EBu-vh(( ׮ͼ" gN3bEI}Hۜ5C~ࣸB`\"%%'7h: Vm@rV8CKob[!(gWeGDPj#D&#Ik'YfDʓE*hnwu:41Je$JB;f~%tz025tl_ͨwpWk༛ƫ"RL#NZ[Pfǒb\Ba(NPˑ- Y$X<`*J!N- ~/g-*0AFAIlф`Gap_t2Gf:O#}TyJc̩, R쥷.Q%$1H)yLRRRJ! =No\3Yg$KfHpb$`1I$I$RI$'LRRI$I& )I$ԟ=X o|/TFa Rra<'jRI$RjNBI( .RDKBI%+M+ pLܕ,Gvi$I$&I$d2tI$I%)$I]ީ+7韂v?R2颔x.2I fyM)%E+`Ѥ,S(Iòp!DT='Q#EV.^)[-# %I$ $$JA2qI)I$I2V&Nqf8X1df8cX,qW*A52ըy,NA{TR9C4L\8(/VdZp[WL. anFa[X5Z[G\N noWR5Qfz z}vdIE}\伃1YI*X\g\ \[2]]܊KDzI;& lG./K~%gfT+yߛU*Bj8RZ"N|aI_l4vVpG8qOW`jJw'3@> Գ> Psle$ tQԸ}Rtaj%y-d&g2m≖M!O.ʧkQn֋$7+s)+SI$I$$I$I)I$I$JRI$I$I-OېGWQX+o۔0B+wMve,Wzw0˥D8D%C7زk5xVy1u,>եZLRI%UJI$' 7JI%h*=5ߣt.qf(lС[P~&R.TM)G (K 2ڴ!NX'B;˖cm:pϢPNY"N[Tِ5UgI#q) TZTȊ/ 7ZG+ڠv?2_+QPx)W 4U\5iS'H"!p c*/Ʊt$UsQEHjx=lh-& ǂ\ $pSJQ%)2xI# eu,DO<"%ESI$"ԉ$E$I'ZʕNk) Ho(=_DfȊA9M+;m wm*\#+&/80:<^\j$"R#f*Bl ou+5N#BEQ*XȅM[r);`k2A*t%g_қ մ*~C5^߬975l6Cndy{w{p_d#l@Td kٌcI =QyVBv+ڝj}4,o yտqH=@BRBbw:/p(2"{<m!# yGyNQjA)mLYpR/S;O)!m0K - J(ʟʈpRTpIK'N7 RJ{)ODTdޑjbAKM< BP"BJa $` RJՏ3HV`$YxvV$ Z-q LsD)? 9IFK30!d0UxpªXBJy(i%Zt: [檂r1w74*25p(a)&,-&EI" u9JT&%%1))Be$ $&OP)iSP':)$0e<% BjehuD6nѼ*> 7H4Q6{I#f<yQ}-q(@R{s M)(I 6 Y)!>(ҥ(M>*[$}`qV]1 N`nPLZ%[ǂ )m0OiI^u3hc^(B )JT]wm ur  1kHP5x$s`# efדmGN}Xw%EH(= ZS Ap$>TFʛLAsPuJO!UP7msV0wgH>Rk)ţ[o!R>gb!% Mrܨx~3!ѢpR(& ~RДRRņ#Wx"wt )nA4JB+ƾ9H2uDܑ JRSHNX VKScrSl8=IH{?8\ :)QT]CO f(zJNFc#EJV$ w1;3wq'E͊ra ΈzR O.]<}tDne2PfҐM' Ω{{W#p5EueC% T麐`&㺦޵Y nLջ9OE#V]Ȅ~nR$!jiq$-7Q/'Sܖ9O04U#Et @8>di2tDܞ4$<$Q‰q૮fA?FFma8qIMy(ƻB&~80~IFaS;Bv9 Zgj_= Su ?T­i+k`̈ '勥ⷾ4;'#<8/^xIVl5Dr)D|M"%D5SQ)J<i,+P/C\__c-I%I% RAJI$)'LLIl|#Fnc> W_kz_w]V!F~E=?.;򕘺x;Π/Lk?8AxպX"ЅUkx(cסw,<Ku)(uWPqV.<uʒW+ld]੟C_GJAH .a$R$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$_I%>I$I$$I$I)I$I$JRI$I$I"⸲֑̭ pO AR`=-k]’bƩD&o AubH:'.JD0 Eò!ഝRT9Ëi wY- y JU7Uu&Hs׋) `[LɭPt Smg\T!BhGMn|VgR@7s1k+d*Tp&kCdr#uL I$'DI$hRܫ'Wʪl! UsIc}B>e0cNQ7Bg --@vL)˓HPekatƟ%OD vT> f 5+hLΒ,j 8*>?ǺqۼTlЫLa#Y'އO )*>pr% տ`IM0,gZmGj Ð_ cʾAj}EUVIEǃ핝)+ԭe^]V+ :9O:\BdJhA] `–9NSQ"D!)LN%Tprp<9>Œ ;PҒ*&QИjBJFBS-Bf/IE); 1Jb\S.RP2Ґ)9Q AKʙI>)IH8M颧u!jRRMA#欖B,Bb;NR41!&k82X5E8T]ڧ6k9W5MAI'Q`B ;! .BVRu֞ҖҊBE0dH0RR(&IKjpK$Czb|QO P! S5aCv@"@R+U&H: nAR-DkTigcU  A MPSd (| ֩"1dT9*ZO!6JR`9QWSCuC}\i:WFsF+bȀ5A>cpAm쉝,۝d*]$ς(%mT,Җ2jέ[f =@C> DJ@@ʉLԦ׶T[bbLh;yRkA$q4MN(p #^T--0 *1mMtUE;Cء)KؒRTPxA.#D Lx)r[))#RݸT DI"5ƝK>gХXD i{))Sܟz[SEmPa_sdhWu244UNQȬ5CNWBCM20hJI0kjiP4}wTU_RlGgYxnTG= D#& R:?Hvu*&Ai:cUtNJD»Ш^}r>]-⹧yAEXFKЗ^XGLH;UTi@L@%-R [e0薓 uLA>,a!0ԤtH,éZx+YARdDY(TbJ hh%g ]WÿG*> 5'e)(T:^x 4uҟ;S(1R<$bBR@.GTc%ĠgXc % 8RQzVuj{gPSszK:'QR+Iku<lЉyWbG o)ƦRD*y,VrBr4Z>dM⊠=W(ݴ=X>uI2RNI$IRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/FiPo~DUW?zܟ1Gg* vrI$,RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$} "7WcöSbb)"$VpIJLI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I'n-0Z!IS 'I$-ʀ> i>|,~U*XUL6Ba,a R 5*t+LL@Urr8gӄU!{u1y.Y&pUkT}^u@B`Qtk63CVAA\=}x hM IhEW>9DGd $ D(95Xb,!X*eb'BX% 'A*I$"UP)`&S1I}5NxPAD"> 2LDLJp9E %84tTJ5UDU>x^,*rdL2ֶI$I$RI$UPEt7RRLlP4RK'W!#iTy =MVx,Ug3pu!<Ӌ|P V+o! -O2LofU<%M'pʕniWSΡcyY4%{;}xOXXvŞ H̪t(VD-NZTaH x;0MeVᗒt_$& $\$RI$$IFRb50|R7Rd-[\nka+u+#ฯ,mi\HX+^jB6.E5Hf Vpx>x(طf ?>Vi{Un ̼ ,cu<&4-9DzN5vAF ^i~}huҾ檋Sm9Q+b *y,KH ʶ,'1TT1nD8G@䐅?LTc_Qv2 sxAx&QKZƠZ[GlLzVyI$w 12Nd~ R-)ÔE R72xC}kqLgTrBTÂ̋YV4%44@uiA~;ڭ5JZ2oP-Xf]oorǍG+<9JUP}ħ\xLafu7VSΈp F,ͭL#5w< T:PJnI a%"BI)ILH߂IB@yM2CJND'vB*l0A$IQx儦5Ҝ\()x Bi#8R h:HI)Q.CM  T%CiEIe9Pi@BtJHILJPAHO8r)$;S)J\4ۡ%#54FQŧ&UPP5k+(WTWg)8Bƞ!|ŁhO׬ /RJNV C@=;%=Һ3ZdVvK9Qߝ @U%#S*S'pSCeAdөQ8W~Y{O*bK T=w jkP?Yliֳ[c[ +_NJC[.ORs8HsޘfNW]~ dthtU~PS&>Pwgn¶cUjNc\MSS}p˺ ?5o$JΫU)`q+9(nm$ b4p9 O`K!f<[Ʒd?BJqfI]hn> @(`6AJ'f HtNk@O{ZSmĪiGca\_mЄ zumӏmԎEZQd=G{(0z/9%T i64jJƄB E+ Bhk}K>7AZ4hYN}@ SIrcUnKӺv{-R+c F"g8=*#qXЭ=$§hʓAwjجWWb#V@ \H1> 3*ݚ>(y\$; k%]jBlm8,~k,geulw['(_V!q]C|[= ovt(aW*0z 05YT+bpЈUnDUY)X߹WoBTk NC\a^}O4 "vP5 Y~:E{gA,;RLU-n5LHYCΉ2ν+St4+qvR!Vk"5ҝǷyUMNǝVByJI3R{SBxB@:4&%;\E k1=]p5SXK]VH :!rvWl@4 WWuLj`[2RAMf\0WdnKe#e0}(Gܜ-oVGGfmV,xWwrv-iBmC+<|T//Χs9FBzf% *oh:+5u::ۊz&SYĨ?mVpANia Aޯu=#Jr9i85MGSŽ*-rwduRDe\86av>RBpꕥsƑ)[„(`H)?GrZmrBM%X>Ue#ݢ% #`GtRDU։ Oh<&-%1ς}9bD/)JR)R¹ :0<ԉuRI2IZ­G{Ο&8HX</l4 }xO6h7 ^Ui N,iآNR-rP#JA1HS 0G),<~(|}75frݶY’b)pBI$&%$I:sdIJI$[XL-u`-o|]w [<*}όςrG~S1I(ЊIߕ4”`蘔&h'HN̄jBR$"S`d򄍒?He ry$I$A2JRI$'RI$_KNl`hд~)@w(IKHQDʩ$ j7O4*I8H/)&Cd"%3LTJcZJ)‰Re:c@֗TW5dH5 ʚbb!QXI2I$I$'LJJRI$v)$@R5ID|Qdm)E AcK\u +iHjqk'PYV٪~rxeb KyLS,ӇbBp( *)Kod|<4+DjVwQ>&Pbo 6{LTnC>iolhw4eHJ?b7.Mb?w&>hBmkI$I$$I$I)I$I$JRI$I$I$(2|Z2HRI$'MRI$wb<3XZ :2Cb FVMRrV%0K&bRB hA+g7Zvs|勩^ZLJIjRI$:9RDH2KnO Dŗ7d1 KxQ|BfWArSY 0(!){{:kj.O6#dXb '_2F"U<|08 l)qmZT&څ9R&))J'T"Q@YGB5/N>L#Ⰿ)$R\I$E2^I)I$Hf,, n\XLxNHAƫ А)cUQ2%. &ITVƅWՅVIM1!Mr5LI<緂tg(ZBtg4QёT1ɐrYΝ/wJʫBvP 9 >$6jhּLxԧ2DHr# Ao鏬cqدgt#DŲGd`*Bt(7) gQ? m9Hm*9eB^3ڢjk+P93n(PMA[%?7c* a-vAP8xƨU" Q'ؓG !!$&]'@}k1 Z]uN"(ftWG(^ K|:@P5h@kdi(܂NxarbiǓ%e8C<꒚"9*l@HV EBޜ:R s 4&ۅn!V4L aI) F:f;)zg$Ɔ:H9H=ZFuwK=}ZR}[P4O]!X"M۱^]VvXKm wE#u uUAYԭu)FjO~djG(̶pD!Ky c sݏGN[2F@SuO(=ARmV9 G#2GiJ EMC]"LHP~0%>Br})Ί~&?'c;C'C(CU!(IMa|Nˋؠ6SBhNR$7F!t=;D%$H)1|t("!13cEL)ALBAMրDYcC6RlCI 2^=(̕4Ic{{>8~xMtBom[QTRN$6%$#3.RdBRǚ4)Sz "$U`yHԇ䀑) W^$2 ϸV#od7R+t0sGl?FJmZSUK(+|Bu-<7` |7 ؉#!%LҟprBMgiBL*r9[i*ͽPo+z> %6Wpcװ4!Y/B2z8JR3VE(&u(b pbH)lp49TL uRBE8H*3%(S &q0aJ4.I'LH)I$I%)I p,eg;Ww'*ЕaDR wtLRH!JtOrhP!8HJ\ ?LHQvPR$ǴJ+K Y˛dIZji&)1TV)$LBI$I&NE%)$IJTa3[ h> cS)&Q&jIQ:HTR? )t)KI$ĨJ& .LJ?H-='E~eʛ8C(QIslLI$yL%)$NLJRI$tRI%&M -[9[T@9KqGRB'TR*dH@q!E7S+2ޛzk-g׺fl&'BJred =H-xꠗ2Q“ ÁBHhc߇Y^_ 61(lJJ8qY:X@YYXê3o:rه')c˿T='Vw}tGi2 0vu R RpD5(+òt)79yMD&B; /DK-ܟ9ҳ[ovBRЂ!d8?[o}, _Y1v3 :5xgxs#R_GߊOJùMw2VYDh v|u^f} . |ߢk?2w)cp|Qid4 / 3=t]2Is#[st+qx}hSN4. 9 zOV^9"+9$)wTY6P}uF^i P j.,.Aݤ#e |!X!З1BRW'L8I]nmY%Y<#0Pُ)N#?M]*x#YVkԲ? c Vp 3B+GqQsP.%B/* dʢ$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$EBiU_yr|)ʂI$I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$K+\_Z_7MsYI%+2I$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI%I%>I$I$$I$I)I$I$JRI$I$I$ps4Yw<:pb  "ʓJt;D S-P׈ ,쎞jB?'4x$fT2 HZ9ŖBDcᆲ/TW@ABDNFu(SBtg'$ӄ$2Gaw?as3*}ZUZ )+= I$I)I$-P:oӅr&ŗcg &쓹WI8M)J$J .I2̇J.p˕39ZI!JQB_RKUaMBIXYwbX %^eoB柂V fg!T *~Rպ-ihpNTWc"xcOu  :vck"Cc\cI"-#PpoipņVv|'Ś@v;X?T /{dW|kт @GWE%q{-I~ ./nrkckVBP$Fʄ4ZR5"*l)?ò a.Ѹ^FʸV{yU) _tC5pUQ,Ysp%@XB*)h0GnKHGR D%ÕQ`<䔶uR4I)^2iRgB@)5(!!ox$H);Bb'OJaeA죶T'cni&9(stxRsC6\8CuNo*m!HXr3w:fpV{õCuo$,Z]JN\q}w6uW4ڨp; Ä3KFRtV[!A.)I RL׃pSBE2*R@IH'JRRĦN SbR  NIKmR192 NŠI)LʗtZJ0 C7)I0m{Ɯ'u cD*^\ݷIBMҥ5[[)8pEH݂3n*b€䄩Mwc'T߹\#U}MN @AH>hVt$|^$1qwd Ra j9ky$Q}B ԩH=tMrGHpF!8jIEVL(o&(bKBjpRR၂(*.IRT%H2Zih!uBuT ۉݢjb[<|꫾uѠ<:`ڋV{ k y#M|QC$ Ps*F&e1(m{>>G]-]_ QWjL:$u/5"ΠR{&˴Y]0j5Pea&EJhfx^&HQ jʅ\@rf lׂ}J:sqZ޸ºމg `ҭTjH.>kn@3N:daII1uH=A9rdpSO Spm Q NTB&ԈIMh7LOOv](dO7k(Z)F{9Uߐb9QQ 0G4H:F%p~IbƩ]I(wI? IJ!qIÆ4ҜQ:'ӖyB&pJ r[@HhqcLhUƶFES) 9EMӵ7!OOt'(RU LH<"NJpRCjQ@vBu\{JR~BUQR`"$nUQVx\"萑aD :Al1@:%0(m|JrZ?f9HU:JLwD&#@9#d=J\smIӴfQh8+#U9?yi{R{urXcȮڹ+:k*2d=fWt'1+ΙE&~KyV(H,/`wṢg< HOnʡUw$ asQb:*[(r'*| BNa(y] Iϋ( Ä18PkVb=_%-/QԔG*L|/Q%J/< nf$٫֌怜sXc$]+pk@B:DŽ0qڗdŽ;4\sTݪO 18J&W3|&s6c)3@L’xM2VI$EI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$^~"b4߀Y?>bTA$IRXI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I%pXE.oЯ-/mr?R EgHs $$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I%>I$I$$I$I)I$I$JRI$I$I$WZWWrFtwR)Y QOvd@SsʑQvTr%fz-Gި8+7FHzg4VKBSDpI5C xǑWTVY[+ aU,x:HtD X Z|KkDTV`Łk۫O`Y: 5T\>\=9f =Bv+A nE4PI*?td<$D$I$IIlakXV u[Z:㏓)DTTQQ,'1d 2 PZy#'T,<*`@HAEO/Y u!`B ?[X:d8,+kxf]਱J#1UBV@f[$e}HxVYwWbME,Q5\(?PR5AJw'̃]-r)m #G%ʝ`pE)$P RI$vBd)A#u$Kr !B2QEI(I1PIJI SLJEJ)Y9X=C骫+$JSP5.5WŴ A)MvJʮOM p+i-Fu2T, ;XR 8CM?@!V4> U%caH @>cf3moyZxp؃nxs]ڽ[q|<;EnaOf] 9y,:=*XRNJB!lrX . ӾP1<&&BgT< JdHЦ wM!#o KV)g:d)ig'8J!ISACPxSKT2 JmsDK ewS F!Pv+ H%4ࢳZl;@`p#T'avVYay४+:+nx,'vz7L(B(|j vkZMgsNl2uH>?%V+UɱBaғznnZŀd{zpE4:>E/P[3P`ט>y@DU`Qd$UAӦ弭['X]vF |5CaD\j_#Ru] aL=8fY2UsAo@3!9`!L-5M)o (Ͳs!f5r;nlH:z^ l!ĠE&u=ݢ^fab5#NT7j`$#% n,p<CW>,{k;ϊJaj%E$,ΧK(̧/IF%; (qSf]${\,c?vH%ڑ4b0πL O[F~.t@΃7T{"OR7'-N{0Ǻ*Q,U9RCSHwLM.a:+A!HGjb"^Co}S %')mΟrȁqP4:|R$T7FSNUp'X䡶R((n93ANۏ8R4ɓ>!I%" .E1&)u3!]p6+E(OIDޛzQSGd;+{ J*@%>fuzʆCu |ϒB>J)_W?PΰW7DT \;+NzR)uts;, PSĪd(|KІpnXȹGΥkNRWu>ez5{:v"MR$d%)$IN% ѣ1)J.IEHPݢq+#jI5%"B[tyJSҤ$I3r'3B[RI"R?d˅̠$NxRY]Dj+'<ď"74F$KbdI$d)I$P$ВI'LI)I$67 } oZ-%݋*.S6Q h2ouʃ:HL ALۡNFRvcvJbJy$L 9JuS:,gD+dKWupL*+I'*hRRN: umr 殡权-|3_;T1 ^?JK w[XG4&|0/֣º.ϒL},@AuQ8MG+?fcI U|&]kS=ʆ FzCE.9(*WsP)`L Jl_ XC֙L5@رrp 8{^xTO# 먷( 풥B n2 K'$l]%F$,p)Ǻu4j%fg7!pxI&ݦޞ=T3aW0mr;% 9 c r6['T;1ς-uEURwrI3`KI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$Kѱo~DT,_U''Qʂ$I*KI$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$BȺEpXEؘ>_GJAH .a$R$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$_I%>I$I$$I$I)I$I$JRI$I$I$z "L疶RI$II2X !k0FdRJ*xWYGiϓ=\ߢTM6Uw=E< %_[ wL< Q+KBjƷ{39HJw/=f.g^lLJ2 ?H$:eYJI$$IktC!]VK" Sk?eG`C[8C=D'1SN\'0TOtġ-B ;3XPUUrs"l|eumʨX:,Ӷg7&)@Sao 3Q.U]s\]8ʳ\U@De+;xfP+qv ʹƑq*C gAx 'uu'פʱ_[%W]WRy>iޙv,RGt9-Rꋈ7ة< ̻wҺzoV{_\tG=9EBdD=,GrzF?"cR{^-%ۚ|T3cl;ANʺ0!]g ņ\?3^<[s\iښ#jUVZɂܖYMconqo[f0Ha#SiXBwIcWۯ JHs1 e"tE'Ψx\F't;)cơ^) $>@[|A(^@ it uD!z]oJތ>{X/WQ×}iˢ2׆D,Kh]^ʳrF[).w V6@VJ~A"ޘ*"-HY> ɶn>\$P 1D0:-T@R%@9#gJD҄0 B'p: ;o))T}'4ʶFFcB+`jTw!IitVVNkYdPH_%JsqS\W`7*~3yUݓ:§3$Vă h-+# 2F h@oò֓ٽTkΪǨ M!VDci\Ĩ/Hq[_e-!SyUg+/=(rv]zn(u,^&_mR:k쵞 t%Щ=k)JtW ]v?@58j!qMgt葿ZQ[(7'wOhBagKOwG ~>~?Q=5E>0ؘ[)zie=WzY)@ es].ѺfFߜ)Vo4x2Oc-{uQ518kB (3(=C%ѹɝ}ΐV4 *Gd8S$Yv:IZ. o HK p+3*CoNzП#)m*J#NT< 06S 5@r2dzb *3UO'Za;U=lwC . [A[]w<[ a:(V#DЇ][FY?Wqp5U B %`MA#ozA80' Z:Vŭv"7T RB[`ypo9*N-8z(rh4N܂z]rP2 h>NAjs9 @5EM 5dSaP{#2d$FPlE=B]Wsn Gd5F@Q7%2 m^f XG a At҅*ލ1Az xKմ}6P)QS yJ#::B"FxBb>j}iW#K:D^KI_\ȄVeVHxO Te8(ZfgS쭖!D׮"ĨP4#BRuWaAƒ )qײkZ>*!ӧK!?i[uAPq2Bˆ [ R э"' ߊ@ 0"S@EI@ Cr8P`:S9MU Qe " 'jJn JUP<ʆ ԞƲ)qE## v?TTLBy=@$TŬSk}ڡAa9H6B9 :AӝHO*;JSBxKPw3HUDF%2o4m _8ps*$%G4%ji%?+0䮲Wu<5p*@=+$^'{K` 1 ^[4*%H5$&HJI$tVAT :.n?d;g(Djt:'E)粝+a)NxRruJPR'`4O F>)VfL2M $%tI$O )I$bS'IJN$I&R ]1I")#DDuYDORЦ)Οą*W'L5(*\#V h%?dj(jL%S`#U[DX?[-N#JS,6I$IIJI$)$JRI$IJpI+4{煟y+Dx{?UGj){= Nr>^h.Bab|Sy|GxU. ; ]YNoޢ#Ea6S 19Âw#Ao芩LLL}J1 7;EW[EX*QJBPQR[͉#ɰwV#huO$%d:ޢ)u2Զܐq*z1(SǛ-1 {ڭ~ #<~]G*SGuT!Q"F "Ҧt=XI2tIBrRI$I%)$LIBJRI$mh1? i-m%݅DYJ!(ƈaI%l212DMkgD JS }RhH@ |nJ%%19D$D(TqpSʽQC{5 ҕ%$I\))I'[GH |-y^wy*ٹdьK> `TwT訇IXZ̳:+[~y2ܢY}a.Sc/?gџGYeνV0FT*u rs%)f𪽻X<լ$ +ع| $Cڈ.BvFJ;$GeH_V̀x*rGU!*%tݔ3{*+^ s_A:`^fVJA+SJb`9RQa}5uHPv*9+ ==dŠyTeЃf)LZR1#uYNu hWвjҙW$|*LQTI$JI$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I/FiPo~DUW?zܟ1Gg* vrI$,RI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$} "7WcöSbb)"$VpIJLI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$II%>I$I$$I$I)I$I$JRI$I$I$tma &;B~3S#u&<'Iv:8 (prDس5P*)S &:mK$C:Jp':"*Lj\0+,*xDB*IL$JI$$JJRI$qBlBЅSxb|X= tMAXRIHjp5'H]$YU6ZVQгW7̙c*5QUuVk-vs׈Y r1I$ R!!ȔIF!gu R!xY%)SŠ]%$RE:JRd"*}wYSǒ@z'vq䮤z_p̪þA9 GymNVu"^Gh[ρDe8 ̅3%a.hB.k[\ BwGǴ>K~+FgZpBV{X>aV+!x󬮁E k!Vde0[eR\d:[ 殆V[a "CSm*;p˗ܟyTj<ϳa%-閱W 㧁 kx*r+]oWmgbycоz 2u }6jk 7#+Ik>KsBf QoWs <+5ZɄ bV{sǂJrqϱ?V=fP*W3+3wHkwI{u mUjX|ڪ}:Y],{CN1埊rPP{zun0?0!6^Sp}r^7Vm}..dm[VT+p1b}eJU{xo{+<Э?eS5)û,z6הB O)hnh. ^r}9jmjbJ}Ta-%-鄋`h- (Ja(Nd5(iJJb8*b;wSutN )@vQb%q) "&RLV1 TV[eO%U )Vit۠S#)7"UirThZG)%Y7<~JI) yjzc Gdq[Z^*nV}~(nו+‰ }%s}o *-Q'Ow;%63 ]컩)9d Ǐc*UZ߽"a TdhAn@ӕ H%8ܠd5Uh:FqM1yCH)*mȹ8? 5LiKcS TR!ZoT]B3z7U]T(T}24MB[Ϊ*Ϩ3Rgd2£]*$Ȉދ <L\o7&tt")*UkAoSFoZpAD>RDBBjSY(쏂γY(ꔼ@)ʌj#wDFdV ({b&S #Ħǝ*x DãBuA.0(9݀ ѷYZvR9j) ;Q sS*$S*:&v>QHrDM7tMI ʑ[Fc)d\Bp:HTVР#TP4eC~c@IŒ&OB '/$!ӁbJ.k,ͮVG7OU`4ىSV^am 4 , [;G=: |7Pdx?7VO a?Ji7 U$>YZRU*{xQl+>kZӠΦ9Zc=)g!@뢶$h2TSlV{q1KiE6@A B)Joc5*Q vKJH&p1)()?蕃o+rӡXv#Y+e:aU`VHXt$p%)$I7 TJRI$IJI !JI$(}2"UlLN Q*Q" * {h’hLuWAJTBR{$Z%@,l Cld;xUNcdI$:RI& $JRI$I'IJI$5+D4Ƌ;V+j(?<$JKArD LDkʑtw Tx'F}Pn_(RvjS'g+1Nre*I$I$I$IJJRI$IJI)I$KK I+4-^?Fr1$n+ EBG5܅aON@ylR1d8%1M*+CwMi_'TRp8Un>)e2i1NIfu#SVxy1tJSBxU$1KyIJN:%.o=|]̚߷ X}!⻿p 1ˇ~Q+А]Ku+ǧޭ,:3{Gz7Ր>+->I8>Ase\nWpPW]EJ%풪%a}5s ԯ+)07;@WWlv Fr0Q2J.*X(,]t^瑩˥Ry⡠N'WЇs@0BdrQbv5iYY)Ң?ڴnQ?IM %U{!+%TdK2a%ʑZ,NǀZX9XV,$@1 c}D , hI$ZI$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$b4߀X7?"*VO=nO;9PI$T)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$I$IJI$I$RI$I$I$I%)$Is\>?t+Kfc1s?|܏Y+8\I$yI$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I$I$I$$I$I)I$I$JRI$I%>I$I$$I$I)I$I$JRI$I$I$$Ik4V1IPTeNTO6BK^= 'Er\C/MBh;:hLJhZ,{fyB<}UYrcMx- Bu}$kC 7 H{Ou%!g5wR)S*etK;D9Q0LyNd ].4Xwy[U"Xıu°wp_2I2C$I$I%)$DGBGYn|0dAw(.H?eI$TS }2sA J%v1՟u_E]>*hdȈꃍle |§16>VhT:=-.ŝB#8\aѹά`+2,g}_>JY V'z+Ϙ@ V$v]{p*fuo8GլyTߋv9^gOȰm}Ea9~atF!?r8{ j(8"!_XYe:5u\K^,p+m<*q H#tSG#}udIZ]2EMOw\nfBn].B<Ġ񾳲2k땾5^\Q(>5vGA %߆'֞Aל#Ugw ڛbJAJxOk QWQ>0U@vR;S؋Iqd1b]²αC8* V=x% uDJ`>oM8TzFDd }l%)e+S{0xTp솎 +JJ&@gw*S[dMZU[. ^P'إSI<$޶IzH{#"96Ķ{+,e4jP-xri>rҜy )fw!@6*<JӉTåc}x!g61kOp3i؇UJB;]aEQ Н.ի0^ߤ-R@EmMoV0KĹT&WrniT&V==%Ez]KUl20h'e3Jr;#2w-gb>.$JqHS:|S":ѷAIݻm'T_}:'1⥵Ip@F;=31;`\6!HHSI;k22$^LþJ'#i˸(l㪛[1˜hdk;3CKK;*\<$T_\t(mk甃`iʐL%&4*ZO(wjk%H*FQ`ZT0Lkg =yBH$k!&MTJ[b#H*RTTe%4˻Rv HG.* rbjpN;' sLgDQ p! >T 4왶J@: ?Hr!v^"S*s|AQk^ϒ8DڣQ,1#;r{(H6JhEM4=-#B@!M %JtKiH^G<:dA`8rpS7THI@}{JO2%E}R;Dײ¸R5ڢބ @JsM>(f+O(>w)JT%cWv* YJ+:H!wy )T}7MӇ]gXlCV+Ϫ+AVwJ]Q%L+hxB2.grp%鄨Z߇ ,f+ΡX`5>J}  ʮ:XoP@ TgT3[*߮i!MwPSNwٜ{jDCw{BSʄ4 [Fah 2@8BFHCܭ&SIХ`|WMc\\'m'Dc}}yu>+:4}hB8!@$i ȕ<Ɯ򓄅7(]⡧d 5N)j0~B9/15%I$RPt$ZE$cbT#)ޢ$7;HTM $"ۂFWU@BKS!L$rT"IYNCb6旧_ ${\7VV Bmuԃ جw` (mn @BXИgt$'ت3ǥRUŮ pSi: :HTdI(btR ^  jAkY9%Ki M07u2XI%"s|RRN) $GM~ D'Lr &9X_3MGo#JRXLlI$$JRI$I$I$I$Iht$yY3E7(PL|A CUp bxvIJ nR h> ErW p2eVֳ*=ʯ* K“D(“9Y \DI2tdI:d%)$H$I)I$AjѬڽǒFBwEAV _S5-кPʢ"<%;xOK M8l$ba SnҢH遐 fs$VV2%͜!12t V[I$*I$1{t -:H˰wFAS?c 2uvTO*I}P2uzP7XT$,SQ=ͭ x,xL0UA_d}8E6jFI$I$$I$I)I$I$JRI$I$I$I$$KK*!GM)RI$84i I%=jW bN_ʄX5C)%!X) yMOG0KgMi:!UQx/B%gzOPZG*AGUkpχtEfeP)S V"Vc:3:VbMJMj%ZX٢,+UfxCz$,ჸE4•_ET)$RXHI$%)$Sn-O, ],l|, T+4$ kIc2IK eck+{u? I$LI#xi;XЅbLGqjBDŽ=GtB;@O{xk)Rn1_!8wA:u.o!BlB< #DQujP~/ٝ4άuWy9 P \(|S+D*";*@{%$&)LtCV9[y Vąe2 Jt,)$O)&NTI)RàY[hdBr*D>4'fU,RO NJbRI2+YfuY?9nQ+AJD2K I%)Rmo :tg(iVН%dgX;dC (xS6LcĴT" x-`*/¶T,(˱B=Y)RBpS5:u@ug!V))"J 3\+GZ7'PSzr5K$AS]I$(0JrBI$7-8V&@AH !t(Y WI$JIRI$*tx&#SI$gu k2#)E)Sm7PTFKNJG4DmBzR-TR[s_plP_ַG[ -6RDR6^>k)BHqeqG( y:>[ !#2.ֻ qA!q ȱE+Uu?V9Dp$k8č~@({y`.V}B5}MĮB$8V8Z%a?VMpT~qozMWZUW^/76aY.8+nuV} Z?4Ygo+wVBڹmz>YqitXCM'~#-2]!Y0ZaK!#Eތi%(f?0?@Bלf4X,$J#q`*,镎`Bp^\CӔn6˸B*_i40DP&CYּs5x,ߊo{)ײ )Έq#u%0iEei*6[NTy"ODb$7DvR'f@LLq,+PAp #䵰gP2>h`$؁4vm^N@>Jʓ[آ%EG^֙w@ d}4< 1N!5IP@f[ $諟pDKXJο3xB3:wDhky@qlotx Q9ڄͦѪQFLn2B#EYnH=.S"I6JiHѮ1O%hc#'^r